MirGeneDB

Gene name

Dre-Let-7-P2b

Family name LET-7 (all species)
MiRBase ID dre-let-7d-2
Paralogues Dre-Let-7-P1a  Dre-Let-7-P1b  Dre-Let-7-P2a  Dre-Let-7-P3a  Dre-Let-7-P3b  Dre-Let-7-P5  Dre-Let-7-P6  Dre-Let-7-P7  Dre-Let-7-P8  Dre-Let-7-P9a  Dre-Let-7-P10a  Dre-Let-7-P10b  Dre-Let-7-P11  Dre-Let-7-P12  Dre-Let-7-P13a  Dre-Let-7-P13b  Dre-Let-7-P14a 
Orthologues Aae-Let-7  Aca-Let-7-P2  Ami-Let-7-P2  Bge-Let-7  Bta-Let-7-P2  Cfa-Let-7-P2  Cgi-Let-7  Cin-Let-7-o2  Cpi-Let-7-P2  Cpo-Let-7-P2  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Ete-Let-7-P2  Hme-Let-7  Hsa-Let-7-P2  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mml-Let-7-P2  Mmu-Let-7-P2  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2  Sha-Let-7-P2  Sko-Let-7  Spu-Let-7  Tca-Let-7  Xtr-Let-7-P2 
Node of Origin (gene) Teleostei
Node of Origin (family) Bilateria
Genome context
(danRer11_plustraces)
chr19: 9429867-9429936 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUGGAUACUGGAGUCUGUGCGCUGCAGGCUGAGGUAGUUGGUUGUAUGGUUUUGCAUCAUAAUCAGCCUGGAGUUAACUGUACAACCUUCUAGCUUUCCCUGCGGUGUCACCAUUACGUCGAGGUGAGU
Get precursor sequence
Structure
        10         20         30        40        50        60    
AAUGGAUACUGGAGUCU-   -|        CU   G   UU            UUGCAUCAUAA 
                  GUG CGCUGCAGG  GAG UAG  GGUUGUAUGGUU           U
                  CAC GUGGCGUCC  UUC AUC  CCAACAUGUCAA           C
UGAGUGGAGCUGCAUUAC   U^        CU   G   UU            UUGAGGUCCGA 
.       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Let-7-P2b_5p

MirBase accessionMIMAT0001762
Sequence
0- UGAGGUAGUUGGUUGUAUGGUU -22
Get sequence
Seed sequenceGAGGUAG
Validated targets TargetScanFish: dre-let-7d
Star sequence

Dre-Let-7-P2b_3p*

MirBase accessionMIMAT0031931
Sequence
48- CUGUACAACCUUCUAGCUUUCC -70
Get sequence