MirGeneDB

Gene name

Dre-Let-7-P11

Family name LET-7 (all species)
MiRBase ID dre-let-7j
Paralogues Dre-Let-7-P1a  Dre-Let-7-P1b  Dre-Let-7-P2a  Dre-Let-7-P2b  Dre-Let-7-P3a  Dre-Let-7-P3b  Dre-Let-7-P5  Dre-Let-7-P6  Dre-Let-7-P7  Dre-Let-7-P8  Dre-Let-7-P9a  Dre-Let-7-P10a  Dre-Let-7-P10b  Dre-Let-7-P12  Dre-Let-7-P13a  Dre-Let-7-P13b  Dre-Let-7-P14a 
Orthologues Aae-Let-7  Aca-Let-7-P11  Ami-Let-7-P11  Bge-Let-7  Bta-Let-7-P11  Cfa-Let-7-P11  Cgi-Let-7  Cli-Let-7-P11  Cpi-Let-7-P11  Cpo-Let-7-P11  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P11  Dpu-Let-7  Ete-Let-7-P11  Gga-Let-7-P11  Hme-Let-7  Hsa-Let-7-P11  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P11  Mml-Let-7-P11  Mmu-Let-7-P11  Ocu-Let-7-P11  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P11  Sha-Let-7-P11  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P11a  Tgu-Let-7-P11b  Xtr-Let-7-P11 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(danRer11_plustraces)
chr6: 41454794-41454872 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAUGGCUGUUUAUCCUUGCCUGUUCUGGGUUGAGGUAGUUGUUUGUACAGUUUUUAGGGUCUGUUAUUCUGCCCUGUUAAGGAGCUAACUGUACAGACUACUGCCUUGCCCAGGGUUGAGCCCACUCAUCUGACAUGGU
Get precursor sequence
Structure
        10         20         30        40        50        60         
UAUGGCUGUUUAUCCUU-  CU-|UU      U        U            UUUAGGGUCUGUUAUU 
                  GC   G  CUGGGU GAGGUAGU GUUUGUACAGUU                C
                  CG   U  GACCCG UUCCGUCA CAGACAUGUCAA                U
UGGUACAGUCUACUCACC  AGU^GG      -        U            UCGAGGAAUUGUCCCG 
       130       120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Let-7-P11_5p

MirBase accessionMIMAT0003015
Sequence
0- UGAGGUAGUUGUUUGUACAGUU -22
Get sequence
Seed sequenceGAGGUAG
Validated targets TargetScanFish: dre-let-7j
Star sequence

Dre-Let-7-P11_3p*

MirBase accessionNone
Sequence
58- CUGUACAGACUACUGCCUUGC -79
Get sequence