MirGeneDB

Gene name

Dno-Mir-92-P1b

Family name MIR-92 (all species)
MiRBase ID dno-mir-92a-2
Paralogues Dno-Mir-92-P1a  Dno-Mir-92-P2  Dno-Mir-92-P3  Dno-Mir-92-P4  Dno-Mir-92-P5 
Orthologues Aca-Mir-92-P1b  Asu-Mir-92  Bfl-Mir-92-o1  Bta-Mir-92-P1b  Cel-Mir-92  Cfa-Mir-92-P1b  Cli-Mir-92-P1b  Cpi-Mir-92-P1b  Cpo-Mir-92-P1b  Ete-Mir-92-P1b  Gga-Mir-92-P1b  Hsa-Mir-92-P1b  Isc-Mir-92  Mdo-Mir-92-P1b  Mml-Mir-92-P1b  Mmu-Mir-92-P1b  Ocu-Mir-92-P1b  Rno-Mir-92-P1b  Sha-Mir-92-P1b  Xtr-Mir-92-P1b 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH573198: 1052961-1053022 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P1b)
Mir-17-P1b JH573198: 1052307-1052362 [+] UCSC Ensembl
Mir-17-P2b JH573198: 1052463-1052525 [+] UCSC Ensembl
Mir-17-P3b JH573198: 1052698-1052758 [+] UCSC Ensembl
Mir-19-P2b JH573198: 1052822-1052884 [+] UCSC Ensembl
Mir-92-P4 JH573198: 1053115-1053179 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGUCUCCAGCAUUUGUACCCAUUCAUCCAUGGGUGGGGAUUUGUUGCAUUACUUGUGCUUAUAUAUAAAGUAUUGCACUUGUCCCGGCCUGUGGAAGAAACGAGGAUUUUAUCGUCUUAUUU
Get precursor sequence
Structure
        10        20          30        40        50        60 
CGUCUCCAGCAUUUGUACCCA--|  A         G     UU  U   U    UGUGCUU 
                       UUC UCCAUGGGU GGGAU  GU GCA UACU       \
                       AAG AGGUGUCCG CCCUG  CA CGU AUGA       A
UUUAUUCUGCUAUUUUAGGAGCA^  A         G     UU  -   U    AAUAUAU 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Dno-Mir-92-P1b_5p* (predicted)

MirBase accessionMIMAT0047583
Sequence
0- GGGUGGGGAUUUGUUGCAUUACU -23
Get sequence
Mature sequence

Dno-Mir-92-P1b_3p

MirBase accessionMIMAT0047582
Sequence
40- UAUUGCACUUGUCCCGGCCUGU -62
Get sequence
Seed sequenceAUUGCAC