MirGeneDB

Gene name

Dno-Mir-8-P1a

Family name MIR-8 (all species)
MiRBase ID
Paralogues Dno-Mir-8-P1b  Dno-Mir-8-P2a  Dno-Mir-8-P3a 
Orthologues Aca-Mir-8-P1a  Ami-Mir-8-P1a  Asu-Mir-8  Bfl-Mir-8-P1  Bta-Mir-8-P1a  Cel-Mir-8  Cfa-Mir-8-P1a  Cgi-Mir-8  Cli-Mir-8-P1a  Cpi-Mir-8-P1a  Cpo-Mir-8-P1a  Cte-Mir-8  Dme-Mir-8  Dpu-Mir-8  Dre-Mir-8-P1a  Ete-Mir-8-P1a  Gga-Mir-8-P1a  Hsa-Mir-8-P1a  Isc-Mir-8  Lgi-Mir-8  Mml-Mir-8-P1a  Mmu-Mir-8-P1a  Ocu-Mir-8-P1a  Pfl-Mir-8  Pmi-Mir-8  Rno-Mir-8-P1a  Sha-Mir-8-P1a  Sko-Mir-8  Spu-Mir-8  Tca-Mir-8  Xtr-Mir-8-P1a 
Node of Origin (gene) Teleostei
Node of Origin (family) Bilateria
Genome context
(dasNov3)
1755814140_name_237830476_mate_1755870925: 802-862 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCUCAGCCGCAGCACCUGGCCCCUGUGGGCAUCUUACUGGACAGUGCUGGACUUCUCAGCUCAGCUCUAACACUGUCUGGUAACGAUGUUCAAANNNNNNNNNNNNNNNNNNNNNNNNNN
Get precursor sequence
Structure
        10        20          30         40        50         
UCCUCAGCCGCAGCACCUGGCCCCUG--        -|   UG       C    CUUCUC 
                            UGGGCAUC UUAC  GACAGUG UGGA      A
                            ACUUGUAG AAUG  CUGUCAC AUCU      G
NNNNNNNNNNNNNNNNNNNNNNNNNNAA        C^   GU       A    CGACUC 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive).
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Dno-Mir-8-P1a_5p*

MirBase accessionNone
Sequence
0- CAUCUUACUGGACAGUGCUGGA -22
Get sequence
Mature sequence

Dno-Mir-8-P1a_3p

MirBase accessionNone
Sequence
38- UAACACUGUCUGGUAACGAUGUU -61
Get sequence
Seed sequenceAACACUG