MirGeneDB

Gene name

Dno-Mir-676

Family name MIR-676 (all species)
MiRBase ID dno-mir-676
Paralogues
Orthologues Cfa-Mir-676  Cpo-Mir-676  Hsa-Mir-676  Mml-Mir-676  Mmu-Mir-676  Ocu-Mir-676  Rno-Mir-676 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(dasNov3)
JH573163: 216137-216193 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCAUAUCAGUUCGUCACCUGAACUCAUGACUCUUCAACUUCAGGACUUGCAGAAUUAAUGGAAUGCCGUCCUAAGGUUGUUGAGUUCUGCGUUUCUGGGCAUUUCAUCUCUAUGGA
Get precursor sequence
Structure
        10         20         30        40        50        
UUCAUAUCAGUUCGUCA-  U-|   U  U     UU      C     UU   GAAUU 
                  CC  GAAC CA GACUC  CAACUU AGGAC  GCA     A
                  GG  UUUG GU UUGAG  GUUGGA UCCUG  CGU     A
AGGUAUCUCUACUUUACG  UC^   C  C     UU      A     C-   AAGGU 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
To
Star sequence

Dno-Mir-676_5p*

MirBase accessionMIMAT0048004
Sequence
0- CUCUUCAACUUCAGGACUUGCA -22
Get sequence
Mature sequence

Dno-Mir-676_3p

MirBase accessionMIMAT0048005
Sequence
36- CCGUCCUAAGGUUGUUGAGUU -57
Get sequence
Seed sequenceCGUCCUA