MirGeneDB

Gene name

Dno-Mir-672

Family name MIR-672 (all species)
MiRBase ID dno-mir-672
Paralogues
Orthologues Cpo-Mir-672  Ete-Mir-672  Mmu-Mir-672  Ocu-Mir-672  Rno-Mir-672 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(dasNov3)
JH581116: 278677-278738 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGCAAGAUGGCAAUCUAGCCCUUUAGUUUUGAGGUUGGUGUACUGUGUGUGAGUAUAUAUAUACUUAUCACACACAGUAGCUAUCUUCAAAAGUGAGGGUGCACAUCUUUCUGAGCCAUCU
Get precursor sequence
Structure
        10         20         30        40        50        60 
UUGCAAGAUGGCAAUCUA-  -|     G        U    G            GUAUAUA 
                   GC CCUUUA UUUUGAGG UGGU UACUGUGUGUGA       \
                   CG GGGAGU AAAACUUC AUCG AUGACACACACU       U
UCUACCGAGUCUUUCUACA  U^     G        U    -            AUUCAUA 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Dno-Mir-672_5p

MirBase accessionMIMAT0048000
Sequence
0- UGAGGUUGGUGUACUGUGUGUGA -23
Get sequence
Seed sequenceGAGGUUG
Star sequence

Dno-Mir-672_3p*

MirBase accessionMIMAT0048001
Sequence
40- ACACACAGUAGCUAUCUUCAAA -62
Get sequence