MirGeneDB

Gene name

Dno-Mir-493

Family name MIR-493 (all species)
MiRBase ID dno-mir-493
Paralogues
Orthologues Bta-Mir-493  Cfa-Mir-493  Cpo-Mir-493  Ete-Mir-493  Hsa-Mir-493  Mml-Mir-493  Mmu-Mir-493  Ocu-Mir-493  Rno-Mir-493 
Node of Origin (gene) Eumetazoa
Node of Origin (family) Eutheria
Genome context
(dasNov3)
JH568228: 5543-5604 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-493)
Mir-337-v1 JH568228: 2142-2201 [-] UCSC Ensembl
Mir-337-v2 JH568228: 2142-2201 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCGCCGCGUGCUCUCUGGCCUCCAGGGCCUUGUACAUGGUAGGCUUUCACCCCUCGGUUGCUUAGCCGGUGAAGGCCUACUGUGUACCAGGCCCUGUGCCAGACUUCAAGUGGACGGACGC
Get precursor sequence
Structure
        10            20        30        40        50        60
CUCGCCGCGUGCUCUCU----|  CUC        U                    CCUCGGU 
                     GGC   CAGGGCCU GUACAUGGUAGGCUUUCACC       U
                     CCG   GUCCCGGA CAUGUGUCAUCCGGAAGUGG       G
CGCAGGCAGGUGAACUUCAGA^  U--        C                    CCGAUUC 
120       110       100          90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Mature sequence

Dno-Mir-493_5p

MirBase accessionMIMAT0047926
Sequence
0- UUGUACAUGGUAGGCUUUCACC -22
Get sequence
Seed sequenceUGUACAU
Star sequence

Dno-Mir-493_3p*

MirBase accessionMIMAT0047927
Sequence
40- UGAAGGCCUACUGUGUACCAGG -62
Get sequence