
Gene name


Family name MIR-455 (all species)
MiRBase ID dno-mir-455
Paralogues Dno-Mir-455-v1 
Orthologues Aca-Mir-455-v2  Ami-Mir-455-v2  Bta-Mir-455-v2  Cfa-Mir-455-v2  Cli-Mir-455-v2  Cpi-Mir-455-v2  Cpo-Mir-455-v2  Ete-Mir-455-v2  Gga-Mir-455-v2  Hsa-Mir-455-v2  Mml-Mir-455-v2  Mmu-Mir-455-v2  Ocu-Mir-455-v2  Rno-Mir-455-v2  Xtr-Mir-455-v2 
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
JH570314: 1028609-1028669 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-455-v2)
Mir-455-v1 JH570314: 1028610-1028667 [+] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10        20         30             40        50         
GCAAGUGCCCCACCCUUCCCU   G-     -----|         U      A   CGUGGAA 
                     GGC  UGAGG     GUAUGUGCCU UGGACU CAU       G
                     CCG  ACUCC     CAUAUACGGG GCCUGA GUA       C
 .       110          100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Star sequence


MirBase accessionMIMAT0047906
Get sequence
Mature sequence


MirBase accessionMIMAT0047907
Get sequence
Seed sequenceCAGUCCG