MirGeneDB

Gene name

Dno-Mir-34-P1

Family name MIR-34 (all species)
MiRBase ID dno-mir-34a
Paralogues Dno-Mir-34-P2a  Dno-Mir-34-P2b  Dno-Mir-34-P3a  Dno-Mir-34-P3c 
Orthologues Aca-Mir-34-P1  Ami-Mir-34-P1  Asu-Mir-34  Bta-Mir-34-P1  Cel-Mir-34  Cfa-Mir-34-P1  Cgi-Mir-34  Cli-Mir-34-P1  Cpi-Mir-34-P1  Cpo-Mir-34-P1  Cte-Mir-34  Dme-Mir-34  Dpu-Mir-34  Dre-Mir-34-P1  Efe-Mir-34  Ete-Mir-34-P1  Gga-Mir-34-P1  Hsa-Mir-34-P1  Lgi-Mir-34  Mdo-Mir-34-P1  Mml-Mir-34-P1  Mmu-Mir-34-P1  Ocu-Mir-34-P1  Pfl-Mir-34  Pmi-Mir-34  Rno-Mir-34-P1  Sha-Mir-34-P1  Sko-Mir-34  Spu-Mir-34  Tca-Mir-34  Xtr-Mir-34-P1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH570376: 123099-123164 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGAGUCCAGGGCCGGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGUAAUAGUGCAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCGGCACGUUGUGGGGCCCGAGCAG
Get precursor sequence
Structure
        10         20         30         40        50        60  
CGAGUCCAGGGCCGGCU-   A- UG     UU        -|  A         UGUGAGUAA 
                  GUG  G  UUUCU  GGCAGUGU CUU GCUGGUUGU         U
                  CAC  C  GAAGA  CCGUCAUA GAA CGACUAACG         A
GACGAGCCCGGGGUGUUG   GG GU     UC        U^  -         AAGGACGUG 
    120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
To
Mature sequence

Dno-Mir-34-P1_5p

MirBase accessionMIMAT0047575
Sequence
0- UGGCAGUGUCUUAGCUGGUUGU -22
Get sequence
Seed sequenceGGCAGUG
Star sequence

Dno-Mir-34-P1_3p*

MirBase accessionMIMAT0047576
Sequence
44- AAUCAGCAAGUAUACUGCCCUA -66
Get sequence