MirGeneDB

Gene name

Dno-Mir-29-P2b-v2

Family name MIR-29 (all species)
MiRBase ID dno-mir-29b-2
Paralogues Dno-Mir-29-P1a  Dno-Mir-29-P1b  Dno-Mir-29-P2a  Dno-Mir-29-P2b-v1 
Orthologues Aca-Mir-29-P2b-v1  Aca-Mir-29-P2b-v2  Ami-Mir-29-P2b-v1  Ami-Mir-29-P2b-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bta-Mir-29-P2b5  Bta-Mir-29-P2b6  Cel-Mir-29-P2  Cfa-Mir-29-P2b-v1  Cfa-Mir-29-P2b-v2  Cgi-Mir-29-P2  Cli-Mir-29-P2b-v1  Cli-Mir-29-P2b-v2  Cpi-Mir-29-P2b-v1  Cpi-Mir-29-P2b-v2  Cpo-Mir-29-P2b  Cte-Mir-29-P2  Dme-Mir-29-P2  Dre-Mir-29-P2b1  Dre-Mir-29-P2b2  Ete-Mir-29-P2b-v1  Ete-Mir-29-P2b-v2  Gga-Mir-29-P2b-v1  Gga-Mir-29-P2b-v2  Hsa-Mir-29-P2b-v1  Hsa-Mir-29-P2b-v2  Mdo-Mir-29-P2b-v1  Mdo-Mir-29-P2b-v2  Mml-Mir-29-P2b-v1  Mml-Mir-29-P2b-v2  Mmu-Mir-29-P2b  Ocu-Mir-29-P2b  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2b3  Rno-Mir-29-P2b4  Sha-Mir-29-P2b-v1  Sha-Mir-29-P2b-v2  Sko-Mir-29-P2  Spu-Mir-29-P2  Tca-Mir-29-P2  Xtr-Mir-29-P2b 
Node of Origin (gene) Amniota
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH570311: 1652050-1652111 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P2b-v2)
Mir-29-P1b JH570311: 1651550-1651607 [-] UCSC Ensembl
Mir-29-P2b-v1 JH570311: 1652049-1652112 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUUCAGUGAGAUCCUCUUCUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAGUAAGAAUUGCUGCACAGCCAAG
Get precursor sequence
Structure
        10           20         30        40        50        60
UCUUCAGUGAGAUCCUCUU---         -|         C      G  U    UUUUCC 
                      CUUCUGGAA GCUGGUUUCA AUGGUG CU AGAU      A
                      GAGGAUUUU UGACUAAAGU UACCAC GA UCUA      U
GAACCGACACGUCGUUAAGAAU         G^         U      -  -    UGUUUC 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-29-P2b-v2_5p*

MirBase accessionMIMAT0047553
Sequence
0- UGGUUUCACAUGGUGGCUUAGAU -23
Get sequence
Mature sequence

Dno-Mir-29-P2b-v2_3p

MirBase accessionMIMAT0047552
Sequence
39- CUAGCACCAUUUGAAAUCAGUGU -62
Get sequence
Seed sequenceUAGCACC