MirGeneDB

Gene name

Dno-Mir-29-P2a

Family name MIR-29 (all species)
MiRBase ID dno-mir-29b-1
Paralogues Dno-Mir-29-P1a  Dno-Mir-29-P1b  Dno-Mir-29-P2b-v1  Dno-Mir-29-P2b-v2 
Orthologues Aca-Mir-29-P2a  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bta-Mir-29-P2a  Cel-Mir-29-P2  Cfa-Mir-29-P2a  Cgi-Mir-29-P2  Cli-Mir-29-P2a  Cpi-Mir-29-P2a  Cpo-Mir-29-P2a  Cte-Mir-29-P2  Dme-Mir-29-P2  Dre-Mir-29-P2a  Ete-Mir-29-P2a  Gga-Mir-29-P2a  Hsa-Mir-29-P2a  Mdo-Mir-29-P2a  Mml-Mir-29-P2a  Mmu-Mir-29-P2a  Ocu-Mir-29-P2a  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2a  Sha-Mir-29-P2a  Sko-Mir-29-P2  Spu-Mir-29-P2  Tca-Mir-29-P2  Xtr-Mir-29-P2a 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH569928: 229489-229552 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P2a)
Mir-29-P1a JH569928: 229093-229152 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAAACAGAACAUAAAGCUUCUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUUUUGGAGAAGACCAACUGCACUUCAAACAG
Get precursor sequence
Structure
        10          20        30         40        50        60  
AAAAAACAGAACAUAAAG--            -|         U      GU     UUUAAAU 
                    CUUCUUCAGGAA GCUGGUUUCA AUGGUG  UUAGA       \
                    GAAGAGGUUUUU UGACUAAAGU UACCAC  GAUCU       A
GACAAACUUCACGUCAACCA            G^         U      --     GUUAGUG 
  120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-29-P2a_5p* (predicted)

MirBase accessionMIMAT0047551
Sequence
0- GCUGGUUUCAUAUGGUGGUUUAGA -24
Get sequence
Mature sequence

Dno-Mir-29-P2a_3p

MirBase accessionMIMAT0047552
Sequence
41- UAGCACCAUUUGAAAUCAGUGUU -64
Get sequence
Seed sequenceAGCACCA