MirGeneDB

Gene name

Dno-Mir-26-P3

Family name MIR-26 (all species)
MiRBase ID dno-mir-26b
Paralogues Dno-Mir-26-P1  Dno-Mir-26-P2 
Orthologues Aca-Mir-26-P3  Bta-Mir-26-P3  Cfa-Mir-26-P3  Cli-Mir-26-P3  Cpi-Mir-26-P3  Cpo-Mir-26-P3  Dre-Mir-26-P3  Ete-Mir-26-P3  Gga-Mir-26-P3  Hsa-Mir-26-P3  Mdo-Mir-26-P3  Mml-Mir-26-P3  Mmu-Mir-26-P3  Ocu-Mir-26-P3  Rno-Mir-26-P3  Sha-Mir-26-P3  Xtr-Mir-26-P3a  Xtr-Mir-26-P3b 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH570238: 465616-465672 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCCCUCACCCCACCCUGCCCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUCUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGGCCGGUGCCCUGCAGCUCUGGGGUGA
Get precursor sequence
Structure
        10          20         30        40        50        
CCCCCUCACCCCACCCU-  -    GA   -|  U        UC          GUGUG 
                  GC CCGG  CCC AGU CAAGUAAU  AGGAUAGGUU     \
                  CG GGCC  GGG UCG GUUCAUUA  UCUUGUCCGA     C
AGUGGGGUCUCGACGUCC  U    GG   C^  -        CC          CCUCU 
     110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Dno-Mir-26-P3_5p

MirBase accessionMIMAT0047541
Sequence
0- UUCAAGUAAUUCAGGAUAGGUU -22
Get sequence
Seed sequenceUCAAGUA
Star sequence

Dno-Mir-26-P3_3p*

MirBase accessionMIMAT0047542
Sequence
35- CCUGUUCUCCAUUACUUGGCUC -57
Get sequence