MirGeneDB

Gene name

Dno-Mir-216-P1b

Family name MIR-216 (all species)
MiRBase ID dno-mir-216b
Paralogues Dno-Mir-216-P1a 
Orthologues Aca-Mir-216-P1b  Ami-Mir-216-P1b  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1b  Cel-Mir-216-P1  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1b  Cpi-Mir-216-P1b  Cpo-Mir-216-P1b  Dme-Mir-216-P1  Dpu-Mir-216-P1  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1b  Gga-Mir-216-P1b  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1b  Mml-Mir-216-P1b  Mmu-Mir-216-P1b  Ocu-Mir-216-P1b  Rno-Mir-216-P1b  Sha-Mir-216-P1b  Tca-Mir-216-P1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH567881: 186854-186915 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUAAAUACAACUUCAAAGUGGCAGACUGGAAAAUCUCUGCAGGCAAAUGUGAUGUCACUAAAGAAAUCACACACUUACCUAUAGAGAUUCUACAGUCUGACAUCUUCAAGCAUCAGAACUGG
Get precursor sequence
Structure
        10          20        30        40        50        60
UUAAAUACAACUUCAAA--|  G       GAA        C   C  A    AUGUCACU 
                   GUG CAGACUG   AAUCUCUG AGG AA UGUG        A
                   UAC GUCUGAC   UUAGAGAU UCC UU ACAC        A
GGUCAAGACUACGAACUUC^  A       AUC        A   A  C    ACUAAAGA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUGUG in loop
Tissue expression
 +
To
Mature sequence

Dno-Mir-216-P1b_5p

MirBase accessionMIMAT0047764
Sequence
0- AAAUCUCUGCAGGCAAAUGUGA -22
Get sequence
Seed sequenceAAUCUCU
Star sequence

Dno-Mir-216-P1b_3p* (predicted)

MirBase accessionMIMAT0047765
Sequence
40- ACACUUACCUAUAGAGAUUCUA -62
Get sequence