MirGeneDB

Gene name

Dno-Mir-210

Family name MIR-210 (all species)
MiRBase ID dno-mir-210
Paralogues
Orthologues Aca-Mir-210  Ami-Mir-210  Bfl-Mir-210  Bta-Mir-210  Cfa-Mir-210  Cgi-Mir-210  Cli-Mir-210  Cpi-Mir-210  Cpo-Mir-210  Cte-Mir-210-P1  Cte-Mir-210-P2  Dme-Mir-210  Dpu-Mir-210  Dre-Mir-210  Efe-Mir-210  Ete-Mir-210  Gga-Mir-210  Hsa-Mir-210  Isc-Mir-210  Lgi-Mir-210  Mml-Mir-210  Mmu-Mir-210  Ocu-Mir-210  Pfl-Mir-210  Pmi-Mir-210  Rno-Mir-210  Sha-Mir-210  Sko-Mir-210  Spu-Mir-210-v1  Spu-Mir-210-v2  Tca-Mir-210-v1  Tca-Mir-210-v2  Xtr-Mir-210 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(dasNov3)
AAGV03299361: 67-126 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGCCCCGCGCCGUUCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCUCCGGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUCCCUGGCAGCGCGACGGCCUGGCCC
Get precursor sequence
Structure
        10          20        30        40         50         
CCGCCCCGCGCCGUUCU--|    C    GG     C   CC   -      C  CGCUGC 
                   CCAGG GCAG  CAGCC CUG  CAC CGCACA UG      U
                   GGUCC UGUC  GUCGG GAC  GUG GCGUGU AC      C
CCCGGUCCGGCAGCGCGAC^    C    UA     C   A-   U      C  CCAGGC 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-210_5p*

MirBase accessionMIMAT0047754
Sequence
0- AGCCCCUGCCCACCGCACACUG -22
Get sequence
Mature sequence

Dno-Mir-210_3p

MirBase accessionMIMAT0047755
Sequence
38- CUGUGCGUGUGACAGCGGCUGA -60
Get sequence
Seed sequenceUGUGCGU