MirGeneDB

Gene name

Dno-Mir-199-P3-v2

Family name MIR-199 (all species)
MiRBase ID dno-mir-199-2
Paralogues Dno-Mir-199-P2-v1  Dno-Mir-199-P2-v2  Dno-Mir-199-P2-v3  Dno-Mir-199-P3-v1  Dno-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P3-v1  Aca-Mir-199-P3-v2  Aca-Mir-199-P3-v3  Ami-Mir-199-P3-v1  Ami-Mir-199-P3-v2  Ami-Mir-199-P3-v3  Bta-Mir-199-P3-v1  Bta-Mir-199-P3-v2  Bta-Mir-199-P3-v3  Cfa-Mir-199-P3-v1  Cfa-Mir-199-P3-v2  Cfa-Mir-199-P3-v3  Cli-Mir-199-P3-v1  Cli-Mir-199-P3-v2  Cli-Mir-199-P3-v3  Cpi-Mir-199-P3-v1  Cpi-Mir-199-P3-v2  Cpi-Mir-199-P3-v3  Cpo-Mir-199-P3-v1  Cpo-Mir-199-P3-v2  Cpo-Mir-199-P3-v3  Dre-Mir-199-P3-v1  Dre-Mir-199-P3-v2  Dre-Mir-199-P3-v3  Ete-Mir-199-P3-v1  Ete-Mir-199-P3-v2  Ete-Mir-199-P3-v3  Gga-Mir-199-P3-v1  Gga-Mir-199-P3-v2  Gga-Mir-199-P3-v3  Hsa-Mir-199-P3-v1  Hsa-Mir-199-P3-v2  Hsa-Mir-199-P3-v3  Mml-Mir-199-P3-v1  Mml-Mir-199-P3-v2  Mml-Mir-199-P3-v3  Mmu-Mir-199-P3-v1  Mmu-Mir-199-P3-v2  Mmu-Mir-199-P3-v3  Ocu-Mir-199-P3-v1  Ocu-Mir-199-P3-v2  Ocu-Mir-199-P3-v3  Rno-Mir-199-P3-v1  Rno-Mir-199-P3-v2  Rno-Mir-199-P3-v3  Sha-Mir-199-P3-v1  Sha-Mir-199-P3-v2  Sha-Mir-199-P3-v3 
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH564958: 197356-197416 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-199-P3-v2)
Mir-199-P3-v1 JH564958: 197356-197416 [+] UCSC Ensembl
Mir-199-P3-v3 JH564958: 197356-197416 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUGGACCAGAGGACACCUCCACUCCGUCUACCCAGUGUUUAGACUAUCUGUUCAGGACUCCCAAAUUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUGGGUUAGACCCUCGGCGCCGC
Get precursor sequence
Structure
        10         20         30        40        50        60
AUGGACCAGAGGACACC-    CU  -|    C       U       U    U AGGACU 
                  UCCA  CC GUCUA CCAGUGU UAGACUA CUGU C      C
                  GGGU  GG CGGAU GGUUACA GUCUGAU GACA G      C
CGCCGCGGCUCCCAGAUU    CG  U^    U       C       -    U UUAAAC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Dno-Mir-199-P3-v2_5p*

MirBase accessionMIMAT0047739
Sequence
0- CCCAGUGUUUAGACUAUCUGUUC -23
Get sequence
Mature sequence

Dno-Mir-199-P3-v2_3p

MirBase accessionMIMAT0047738
Sequence
38- UACAGUAGUCUGCACAUUGGUUA -61
Get sequence
Seed sequenceACAGUAG