MirGeneDB

Gene name

Dno-Mir-193-P2b

Family name MIR-193 (all species)
MiRBase ID dno-mir-365-1
Paralogues Dno-Mir-193-P1a  Dno-Mir-193-P1b  Dno-Mir-193-P2a 
Orthologues Ami-Mir-193-P2b  Bta-Mir-193-P2b  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cfa-Mir-193-P2b  Cgi-Mir-193-P2  Cli-Mir-193-P2b  Cpi-Mir-193-P2b  Cpo-Mir-193-P2b  Cte-Mir-193-P2  Dre-Mir-193-P2b1  Ete-Mir-193-P2b  Gga-Mir-193-P2b  Hsa-Mir-193-P2b  Lgi-Mir-193-P2  Mml-Mir-193-P2b  Mmu-Mir-193-P2b  Ocu-Mir-193-P2b  Pfl-Mir-193-P2  Pmi-Mir-193-P2  Rno-Mir-193-P2b  Sha-Mir-193-P2b  Sko-Mir-193-P2  Tca-Mir-193-P2  Xtr-Mir-193-P2b 
Node of Origin (gene) Teleostei
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH569587: 2255954-2256014 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P2b)
Mir-193-P1b JH569587: 2251302-2251361 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCAGAUGGUUCGUUACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUACUCUUGCAGUAUUCCUCGGGGACUCUG
Get precursor sequence
Structure
        10          20        30        40        50        60 
CCCAGAUGGUUCGUUACC--|     AA        AC           GA    UUUCCAU 
                    GCAGGG  AAUGAGGG  UUUUGGGGGCA  UGUG       \
                    CGUUCU  UUAUUCCU  AAAAUCCCCGU  AUAC       U
GUCUCAGGGGCUCCUUAUGA^     CA        A-           A-    UAUCACC 
 .       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-193-P2b_5p*

MirBase accessionMIMAT0047835
Sequence
0- AGGGACUUUUGGGGGCAGAUGUG -23
Get sequence
Mature sequence

Dno-Mir-193-P2b_3p

MirBase accessionMIMAT0047836
Sequence
40- UAAUGCCCCUAAAAAUCCUUA -61
Get sequence
Seed sequenceAAUGCCC