MirGeneDB

Gene name

Dno-Mir-184

Family name MIR-184 (all species)
MiRBase ID dno-mir-184
Paralogues
Orthologues Aca-Mir-184  Ami-Mir-184  Asu-Mir-184  Bfl-Mir-184  Bta-Mir-184  Cfa-Mir-184  Cgi-Mir-184-P7  Cgi-Mir-184-P8a  Cgi-Mir-184-P8b  Cgi-Mir-184-P8c  Cgi-Mir-184-P8d  Cgi-Mir-184-P9  Cgi-Mir-184-P10  Cgi-Mir-184-P11  Cgi-Mir-184-P12  Cgi-Mir-184-P13a  Cgi-Mir-184-P13b  Cgi-Mir-184-P14  Cgi-Mir-184-P15a1  Cgi-Mir-184-P15a2  Cgi-Mir-184-P15a3  Cgi-Mir-184-P15a4  Cgi-Mir-184-P15a5  Cgi-Mir-184-P15a6  Cgi-Mir-184-P15a7  Cgi-Mir-184-P15b  Cgi-Mir-184-P15c  Cgi-Mir-184-P15d  Cgi-Mir-184-P15e1  Cgi-Mir-184-P15e2  Cgi-Mir-184-P15e3  Cgi-Mir-184-P15f  Cgi-Mir-184-P15g1  Cgi-Mir-184-P15g2  Cgi-Mir-184-P15g3  Cgi-Mir-184-P15h  Cgi-Mir-184-P15i  Cgi-Mir-184-P15j  Cgi-Mir-184-P15k  Cgi-Mir-184-P15l1  Cgi-Mir-184-P15l2  Cgi-Mir-184-P15m  Cgi-Mir-184-P15n  Cgi-Mir-184-P15o  Cgi-Mir-184-P15p  Cgi-Mir-184-P15q  Cgi-Mir-184-P15r  Cgi-Mir-184-P15s  Cgi-Mir-184-P15t  Cgi-Mir-184-P15u  Cli-Mir-184  Cpi-Mir-184  Cpo-Mir-184  Cte-Mir-184-P3  Cte-Mir-184-P4  Dme-Mir-184  Dpu-Mir-184  Dre-Mir-184-P1  Dre-Mir-184-P2  Efe-Mir-184-o1  Efe-Mir-184-o2  Efe-Mir-184-o3  Efe-Mir-184-o4  Ete-Mir-184  Gga-Mir-184  Hsa-Mir-184  Isc-Mir-184  Lgi-Mir-184-P5  Lgi-Mir-184-P6  Mdo-Mir-184  Mml-Mir-184  Mmu-Mir-184  Ocu-Mir-184  Pfl-Mir-184  Pmi-Mir-184  Rno-Mir-184  Sha-Mir-184  Sko-Mir-184  Spu-Mir-184  Tca-Mir-184  Xtr-Mir-184 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH579681: 318736-318798 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCAUCAGAACAUUGCCAGCCAGUCACAUCCCCUUAUCACUUUUCCAGCCCAGCUUUCUAACUCGAAGUGUUGGACGGAGAACUGAUAAGGGUAGGUGACUGACAUCUGCAGCCUCUGGAAGC
Get precursor sequence
Structure
        10        20         30        40        50        60  
UUCAUCAGAACAUUGCCAGC-|      AUC         C      AGC     UUUCUAA 
                     CAGUCAC   CCCUUAUCA UUUUCC   CCAGC       \
                     GUCAGUG   GGGAAUAGU AAGAGG   GGUUG       C
CGAAGGUCUCCGACGUCUACA^      GAU         C      CA-     UGAAGCU 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-184_5p* (predicted)

MirBase accessionMIMAT0047703
Sequence
0- CCCUUAUCACUUUUCCAGCCCAGC -24
Get sequence
Mature sequence

Dno-Mir-184_3p

MirBase accessionMIMAT0047704
Sequence
41- UGGACGGAGAACUGAUAAGGGU -63
Get sequence
Seed sequenceGGACGGA