MirGeneDB

Gene name

Dno-Mir-15-P2b

Family name MIR-15 (all species)
MiRBase ID dno-mir-16b
Paralogues Dno-Mir-15-P1a  Dno-Mir-15-P1b  Dno-Mir-15-P1c  Dno-Mir-15-P1d  Dno-Mir-15-P2a  Dno-Mir-15-P2c  Dno-Mir-15-P2d 
Orthologues Aca-Mir-15-P2b  Ami-Mir-15-P2b  Bta-Mir-15-P2b  Cfa-Mir-15-P2b  Cli-Mir-15-P2b  Cpo-Mir-15-P2b  Dre-Mir-15-P2b  Ete-Mir-15-P2b  Gga-Mir-15-P2b  Hsa-Mir-15-P2b  Mdo-Mir-15-P2b  Mml-Mir-15-P2b  Mmu-Mir-15-P2b  Ocu-Mir-15-P2b  Rno-Mir-15-P2b  Sha-Mir-15-P2b  Xtr-Mir-15-P2b 
Node of Origin (gene) Vertebrata
Node of Origin (family) Olfactores
Genome context
(dasNov3)
JH568701: 737337-737401 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-15-P2b)
Mir-15-P1b JH568701: 737188-737247 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUGGAAGGACUGACAUACUUGUUCCGCUCUAGCAGCACGUAAAUAUUGGCGUAGUGAAAUAAAUAUUAAACACCAAUAUUAUUGUGCUGCUCUAGUGUGACAGGGAUAUGGCAACUAUUAUCAU
Get precursor sequence
Structure
        10          20        30        40        50        60  
UUUGGAAGGACUGACAUA--|    UC    CU         UA        C  AGUGAAAU 
                    CUUGU  CGCU  AGCAGCACG  AAUAUUGG GU        \
                    GGACA  GUGA  UCGUCGUGU  UUAUAACC CA        A
UACUAUUAUCAACGGUAUAG^    GU    UC         UA        A  AAUUAUAA 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-15-P2b_5p

MirBase accessionMIMAT0047507
Sequence
0- UAGCAGCACGUAAAUAUUGGCGU -23
Get sequence
Seed sequenceAGCAGCA
Star sequence

Dno-Mir-15-P2b_3p*

MirBase accessionMIMAT0047508
Sequence
42- ACCAAUAUUAUUGUGCUGCUCUA -65
Get sequence