MirGeneDB

Gene name

Dno-Mir-144-v1

Family name MIR-144 (all species)
MiRBase ID dno-mir-144
Paralogues Dno-Mir-144-v2 
Orthologues Aca-Mir-144-v1  Ami-Mir-144-v1  Bta-Mir-144-v1  Cfa-Mir-144-v1  Cli-Mir-144-v1  Cpi-Mir-144-v1  Cpo-Mir-144-v1  Ete-Mir-144-v1  Gga-Mir-144-v1  Hsa-Mir-144-v1  Mml-Mir-144-v1  Mmu-Mir-144-v1  Ocu-Mir-144-v1  Rno-Mir-144-v1  Sha-Mir-144-v1  Xtr-Mir-144-v1 
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH563368: 9611-9668 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-144-v1)
Mir-144-v2 JH563368: 9611-9668 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAUGUCCCGUCCCCUGCAGGGCCCUGGCUGGGAUAUCAUCAUAUACUGUAAGUUUGCAAUGAGAUACUACAGUAUAGAUGAUGUACUAGUCCGGGUACCCCAGCUCUGGAGCCUGACA
Get precursor sequence
Structure
        10        20          30        40        50         
CAUGUCCCGUCCCCUGCA   --|  U      G        A         A  UUGCA 
                  GGG  CCC GGCUGG AUAUCAUC UAUACUGUA GU     A
                  CCC  GGG CUGAUC UGUAGUAG AUAUGACAU CA     U
ACAGUCCGAGGUCUCGAC   AU^  C      A        -         -  UAGAG 
      110       100        90        80         70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Dno-Mir-144-v1_5p

MirBase accessionMIMAT0047661
Sequence
0- GGAUAUCAUCAUAUACUGUAAGU -23
Get sequence
Seed sequenceGAUAUCA
Star sequence

Dno-Mir-144-v1_3p*

MirBase accessionMIMAT0047662
Sequence
36- CUACAGUAUAGAUGAUGUACUA -58
Get sequence