MirGeneDB

Gene name

Dno-Mir-142-P1-v1

Family name MIR-142 (all species)
MiRBase ID dno-mir-142
Paralogues Dno-Mir-142-P1-v2  Dno-Mir-142-P1-v3 
Orthologues Ami-Mir-142-P1-v1  Ami-Mir-142-P1-v2  Ami-Mir-142-P1-v3  Ami-Mir-142-P1-v4  Bta-Mir-142-P1-v1  Bta-Mir-142-P1-v2  Bta-Mir-142-P1-v3  Bta-Mir-142-P1-v4  Cfa-Mir-142-P1-v1  Cfa-Mir-142-P1-v2  Cfa-Mir-142-P1-v3  Cfa-Mir-142-P1-v4  Cli-Mir-142-P1-v1  Cli-Mir-142-P1-v2  Cli-Mir-142-P1-v3  Cli-Mir-142-P1-v4  Cpi-Mir-142-P1-v1  Cpi-Mir-142-P1-v2  Cpi-Mir-142-P1-v3  Cpi-Mir-142-P1-v4  Cpo-Mir-142-P1-v1  Cpo-Mir-142-P1-v2  Cpo-Mir-142-P1-v3  Cpo-Mir-142-P1-v4  Dre-Mir-142-P1-v1  Dre-Mir-142-P1-v2  Dre-Mir-142-P1-v3  Dre-Mir-142-P1-v4  Ete-Mir-142-P1-v1  Ete-Mir-142-P1-v2  Ete-Mir-142-P1-v3  Ete-Mir-142-P1-v4  Gga-Mir-142-P1-v1  Gga-Mir-142-P1-v2  Gga-Mir-142-P1-v3  Hsa-Mir-142-P1-v1  Hsa-Mir-142-P1-v2  Hsa-Mir-142-P1-v3  Mml-Mir-142-P1-v1  Mml-Mir-142-P1-v2  Mml-Mir-142-P1-v3  Mml-Mir-142-P1-v4  Mmu-Mir-142-P1-v1  Mmu-Mir-142-P1-v2  Mmu-Mir-142-P1-v3  Mmu-Mir-142-P1-v4  Ocu-Mir-142-P1-v1  Ocu-Mir-142-P1-v2  Ocu-Mir-142-P1-v3  Ocu-Mir-142-P1-v4  Rno-Mir-142-P1-v1  Rno-Mir-142-P1-v2  Rno-Mir-142-P1-v3  Rno-Mir-142-P1-v4  Sha-Mir-142-P1-v1  Sha-Mir-142-P1-v2  Sha-Mir-142-P1-v3  Sha-Mir-142-P1-v4  Xtr-Mir-142-P1a-v1  Xtr-Mir-142-P1a-v2  Xtr-Mir-142-P1a-v3  Xtr-Mir-142-P1a-v4  Xtr-Mir-142-P1b-v1  Xtr-Mir-142-P1b-v2  Xtr-Mir-142-P1b-v3  Xtr-Mir-142-P1b-v4 
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH568468: 518900-518958 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-142-P1-v1)
Mir-142-P1-v2 JH568468: 518900-518958 [-] UCSC Ensembl
Mir-142-P1-v3 JH568468: 518900-518958 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAUACGGACAGACAGACAGUGCAGUCACCCAUAAAGUAGAAAGCACUACUAACAGCACUGGAGGGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUGGGCUUCGGAGACGCCGC
Get precursor sequence
Structure
        10          20        30        40        50         
GCAUACGGACAGACAGA--|      G   C           A         UAACAGCA 
                   CAGUGCA UCA CCAUAAAGUAG AAGCACUAC        \
                   GUCAUGU AGU GGUAUUUCAUC UUUGUGAUG        C
CGCCGCAGAGGCUUCGGGU^      G   A           C         UGGGAGGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-142-P1-v1_5p

MirBase accessionMIMAT0047657
Sequence
0- CAUAAAGUAGAAAGCACUACU -21
Get sequence
Seed sequenceAUAAAGU
Star sequence

Dno-Mir-142-P1-v1_3p*

MirBase accessionMIMAT0047658
Sequence
38- UAGUGUUUCCUACUUUAUGGA -59
Get sequence