MirGeneDB

Gene name

Dno-Mir-135-P2

Family name MIR-135 (all species)
MiRBase ID dno-mir-135a-2
Paralogues Dno-Mir-135-P1  Dno-Mir-135-P3 
Orthologues Aca-Mir-135-P2  Ami-Mir-135-P2  Bta-Mir-135-P2  Cfa-Mir-135-P2  Cli-Mir-135-P2  Cpi-Mir-135-P2  Cpo-Mir-135-P2  Dre-Mir-135-P2  Ete-Mir-135-P2  Gga-Mir-135-P2  Hsa-Mir-135-P2  Mml-Mir-135-P2  Mmu-Mir-135-P2  Ocu-Mir-135-P2  Rno-Mir-135-P2  Sha-Mir-135-P2  Xtr-Mir-135-P2 
Node of Origin (gene) Teleostei
Node of Origin (family) Chordata
Genome context
(dasNov3)
JH569142: 1448131-1448190 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCGACCAAGAUAAAUUCACUCUAGUGCUUUAUGGCUUUUUAUUCCUAUGUGAUAGUAAUAAAGUCUCAUGUAGGGAUGGAAGCCAUGAAAUACAUUGUGAAAAAUCAUCAACUAAGAAG
Get precursor sequence
Structure
        10           20        30        40        50          
CCCGACCAAGAUAAAUU---|  UCUA   C            U           AUAGUAA 
                    CAC    GUG UUUAUGGCUUUU AUUCCUAUGUG       \
                    GUG    CAU AAGUACCGAAGG UAGGGAUGUAC       U
GAAGAAUCAACUACUAAAAA^  UUA-   A            -           UCUGAAA 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-135-P2_5p

MirBase accessionMIMAT0047639
Sequence
0- UAUGGCUUUUUAUUCCUAUGUG -22
Get sequence
Seed sequenceAUGGCUU
Star sequence

Dno-Mir-135-P2_3p*

MirBase accessionMIMAT0047641
Sequence
39- UGUAGGGAUGGAAGCCAUGAA -60
Get sequence