MirGeneDB

Gene name

Dno-Mir-135-P1

Family name MIR-135 (all species)
MiRBase ID dno-mir-135a-1
Paralogues Dno-Mir-135-P2  Dno-Mir-135-P3 
Orthologues Aca-Mir-135-P1  Ami-Mir-135-P1  Bta-Mir-135-P1  Cfa-Mir-135-P1  Cli-Mir-135-P1  Cpi-Mir-135-P1  Cpo-Mir-135-P1  Dre-Mir-135-P1  Ete-Mir-135-P1  Gga-Mir-135-P1a  Gga-Mir-135-P1b  Hsa-Mir-135-P1  Mml-Mir-135-P1  Mmu-Mir-135-P1  Ocu-Mir-135-P1  Rno-Mir-135-P1 
Node of Origin (gene) Teleostei
Node of Origin (family) Chordata
Genome context
(dasNov3)
JH567460: 186933-186992 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCGGAGCAGCCCCAGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCUACUGCUCACUCAUAUAGGGAUUGGAGCCUUGGCGCACGGCGGGGACGGCCAACGGAGGGCUCU
Get precursor sequence
Structure
        10          20        30        40        50          
AGCGGAGCAGCCCCAGG--|        UCU   U      UU            UUCUAC 
                   CCUCGCUGU   CUA GGCUUU  AUUCCUAUGUGA      \
                   GGGGCGGCA   GGU CCGAGG  UAGGGAUAUACU      U
UCUCGGGAGGCAACCGGCA^        CGC   U      U-            CACUCG 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-135-P1_5p

MirBase accessionMIMAT0047639
Sequence
0- UAUGGCUUUUUAUUCCUAUGUGA -23
Get sequence
Seed sequenceAUGGCUU
Star sequence

Dno-Mir-135-P1_3p*

MirBase accessionMIMAT0047640
Sequence
39- UAUAGGGAUUGGAGCCUUGGC -60
Get sequence