MirGeneDB

Gene name

Dno-Mir-130-P4a

Family name MIR-130 (all species)
MiRBase ID dno-mir-454
Paralogues Dno-Mir-130-P1a  Dno-Mir-130-P1b  Dno-Mir-130-P2a  Dno-Mir-130-P2b 
Orthologues Bta-Mir-130-P4a  Cfa-Mir-130-P4a  Cpo-Mir-130-P4a  Dre-Mir-130-P4a  Hsa-Mir-130-P4a  Mml-Mir-130-P4a  Sha-Mir-130-P4a 
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH569978: 830677-830741 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAUAUCCUGUUUAUUACCAGAUCCUAGAACCCUAUCGAUAUUGUCUCUGCUGUGUAAAUAGCUCUGAGUAGUGCAAUAUUGCUUAUAGGGUUUUAGUGUUUGGGAAGAACAAUGGGCAGGUUG
Get precursor sequence
Structure
        10          20        30           40        50        60 
AAAAUAUCCUGUUUAUUA--     UC            ---|        CU     GUGUAAA 
                    CCAGA  CUAGAACCCUAU   CGAUAUUGU  CUGCU       \
                    GGUUU  GAUUUUGGGAUA   GUUAUAACG  GAUGA       U
GUUGGACGGGUAACAAGAAG     GU            UUC^        U-     GUCUCGA 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Dno-Mir-130-P4a_5p*

MirBase accessionMIMAT0047904
Sequence
0- ACCCUAUCGAUAUUGUCUCUGCU -23
Get sequence
Mature sequence

Dno-Mir-130-P4a_3p

MirBase accessionMIMAT0047905
Sequence
40- UAGUGCAAUAUUGCUUAUAGGGUUU -65
Get sequence
Seed sequenceAGUGCAA