MirGeneDB

Gene name

Dno-Mir-127

Family name MIR-127 (all species)
MiRBase ID dno-mir-127
Paralogues
Orthologues Bta-Mir-127  Cfa-Mir-127  Cpo-Mir-127  Ete-Mir-127  Hsa-Mir-127  Mml-Mir-127  Mmu-Mir-127  Ocu-Mir-127  Rno-Mir-127 
Node of Origin (gene) Eutheria
Node of Origin (family) Eutheria
Genome context
(dasNov3)
JH578221: 5211-5266 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-127)
Mir-433 JH578221: 4095-4168 [+] UCSC Ensembl
Mir-432 JH578221: 6661-6729 [+] UCSC Ensembl
Mir-136-v1 JH578221: 6860-6915 [+] UCSC Ensembl
Mir-136-v2 JH578221: 6860-6915 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCGUCGUCCAGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCCUCAUCUGCUUCGUACG
Get precursor sequence
Structure
        10        20          30        40        50        
CUCGUCGUCCAGAUCACUGUC--|  A   U   G         G  C      UCAGA 
                       UCC GCC GCU AAGCUCAGA GG UCUGAU     \
                       AGG UGG CGG UUCGAGUCU CC AGGCUA     A
GCAUGCUUCGUCUACUCCUCUGA^  C   U   -         G  U      CUAGA 
    110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-127_5p*

MirBase accessionMIMAT0047619
Sequence
0- CUGAAGCUCAGAGGGCUCUGAUU -23
Get sequence
Mature sequence

Dno-Mir-127_3p

MirBase accessionMIMAT0047620
Sequence
34- UCGGAUCCGUCUGAGCUUGGCU -56
Get sequence
Seed sequenceCGGAUCC