MirGeneDB

Gene name

Dno-Mir-126-v1

Family name MIR-126 (all species)
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-126
Paralogues Dno-Mir-126-v2  Dno-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(dasNov3)
JH581765: 17334-17392 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v2 JH581765: 17334-17392 [+] UCSC Ensembl
Mir-126-v3 JH581765: 17334-17392 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCCGGGCAGCGCCUGUGCUGGCGACGGGCCAUUAUUACUUUUGGUACGCGCUGUGACGCUUCAAACUCGUACCGUGAGUAAUAAUGCGCCGUCGGCAGCCCGACACCGAGACCGCGGC
Get precursor sequence
Structure
        10          20         30        40        50         
CCCCGGGCAGCGCCUGU--    G      -| C          U       CGCUGUGAC 
                   GCUG CGACGG GC AUUAUUACUU UGGUACG         \
                   CGAC GCUGCC CG UAAUAAUGAG GCCAUGC         G
CGGCGCCAGAGCCACAGCC    G      G^ -          U       UCAAACUUC 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-126-v1_5p

MirBase accessionMIMAT0047617
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Seed sequenceAUUAUUA
Star sequence

Dno-Mir-126-v1_3p*

MirBase accessionMIMAT0047618
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence