MirGeneDB

Gene name

Dno-Let-7-P1

Family name LET-7 (all species)
MiRBase ID dno-let-7c-2
Paralogues Dno-Let-7-P3  Dno-Let-7-P4  Dno-Let-7-P5  Dno-Let-7-P6  Dno-Let-7-P7  Dno-Let-7-P8  Dno-Let-7-P9  Dno-Let-7-P10  Dno-Let-7-P11  Dno-Let-7-P12 
Orthologues Aca-Let-7-P1  Ami-Let-7-P1  Bta-Let-7-P1  Cfa-Let-7-P1  Cgi-Let-7  Cli-Let-7-P1  Cpi-Let-7-P1  Cpo-Let-7-P1  Cte-Let-7  Dme-Let-7  Dpu-Let-7  Dre-Let-7-P1a  Dre-Let-7-P1b  Ete-Let-7-P1  Gga-Let-7-P1  Hsa-Let-7-P1  Isc-Let-7  Lgi-Let-7  Mml-Let-7-P1  Mmu-Let-7-P1  Ocu-Let-7-P1  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1  Sha-Let-7-P1  Sko-Let-7  Spu-Let-7  Tca-Let-7 
Node of Origin (gene) Teleostei
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH568225: 2292916-2292982 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P1)
Mir-10-P2a JH568225: 2298254-2298310 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCGGCCCUUGUGAUUGCAUGUUCCCAGGUUGAGGUAGUAGGUUGUAUGGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCUUGGGUCUUGCGCAAAGCAACGUGGCGAAA
Get precursor sequence
Structure
        10           20        30        40        50        60   
UCCGGCCCUUGUGAUUG---| UGUU      UU   G   U             UAGAAUUACA 
                    CA    CCCAGG  GAG UAG AGGUUGUAUGGUU          \
                    GU    GGGUUC  UUC AUC UCCGACAUGUCAA          U
AAAGCGGUGCAACGAAACGC^ UCU-      CU   G   C             UAGAGGGAAC 
     120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Let-7-P1_5p

MirBase accessionMIMAT0047475
Sequence
0- UGAGGUAGUAGGUUGUAUGGUU -22
Get sequence
Seed sequenceGAGGUAG
Star sequence

Dno-Let-7-P1_3p* (predicted)

MirBase accessionMIMAT0047476
Sequence
45- CUGUACAGCCUCCUAGCUUUCC -67
Get sequence