MirGeneDB

Gene name

Dmo-Novel-3-v2

Family name DMO-NOVEL-3 (all species)
MiRBase ID
Paralogues Dmo-Novel-3-v1 
Orthologues
Node of Origin (gene) D. mojavensis
Node of Origin (family) D. mojavensis
Genome context
(Dmoj_caf1)
scaffold_6308: 1300635-1300699 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUUUAUAUAUCUAAUUGGUGUCUUUUGAGCUUUGCCCAGAAGAUCUCACUAAUUUGUUUUAGAUUUCGUUAUUGAGAUAUUCUGAGCAAGCAUAAAAGGCUGCCACCAGCAACAGCUGAUACA
Get precursor sequence
Structure
        10         20         30        40        50        60  
AUAUUUAUAUAUCUAAU-    -|       A    U  C     G      CUAAUUUGUUU 
                  UGGU GUCUUUUG GCUU GC CAGAA AUCUCA           U
                  ACCG CGGAAAAU CGAA CG GUCUU UAGAGU           A
ACAUAGUCGACAACGACC    U^       A    -  A     A      UAUUGCUUUAG 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Novel-3-v2_5p*

MirBase accessionNone
Sequence
0- GCUUUGCCCAGAAGAUCUCACU -22
Get sequence
Mature sequence

Dmo-Novel-3-v2_3p

MirBase accessionNone
Sequence
44- UGAGAUAUUCUGAGCAAGCAU -65
Get sequence
Seed sequenceGAGAUAU