MirGeneDB

MirGeneDB ID

Dmo-Mir-956-v1

Family name MIR-956 (all species)
Seed UUCGAGA
Species Fruit fly (Drosophila mojavensis)
MiRBase ID
Paralogues Dmo-Mir-956-v2 
Orthologues Dan-Mir-956-v1  Dme-Mir-956-v1 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dmoj_caf1)
scaffold_6680: 18620895-18620985 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUAUAUGUGCGAAAUUCAACGAUCGUUAUCGUGUUUGGAAUGGUCUCGUUAGCUAACGGAUGAACAUUAACCAAAGCGCACCUUACGGCGUAGUGUAGUUUCGAGACCACUCUAAUCCAUUGCACCGUUUCUUUCCAUAUGCAAAUUUCCA
Get precursor sequence
Structure
        10        20        30              40        50        60        70     
UUAUAUGUGCGAAAUUCAACGAUCGUUAUC    ------|    A        UU    AACGGAUGAACAUUAACCAA 
                              GUGU      UUGGA UGGUCUCG  AGCU                    A
                              CACG      AAUCU ACCAGAGC  UUGA                    G
ACCUUUAAACGUAUACCUUUCUUUGC----    UUACCU^    C        U-    UGUGAUGCGGCAUUCCACGC 
 .       140       130           120       110        100        90        80
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-956-v1_5p*

MirBase accessionNone
Sequence
0- GUGUUUGGAAUGGUCUCGUUAGCU -24
Get sequence
Mature sequence

Dmo-Mir-956-v1_3p

MirBase accessionNone
Sequence
68- UUUCGAGACCACUCUAAUCCAUU -91
Get sequence