
Gene name


Family name MIR-9540 (all species)
MiRBase ID
Node of Origin (gene) D. repleta + D. virilis group
Node of Origin (family) D. repleta + D. virilis group
Genome context
scaffold_6540: 6632480-6632542 [+] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50        60 
GUCUAUAUGAAAUAAAU---|       A   A          UA          AUUUGUGU 
                    UUUAUAUG CAU AUUCGUACGU  CACUGAACAG        \
                    AAAUGUAU GUA UAAGUGUGUA  GUGACUUGUC        A
UAAGUAGAAGCGACGGAGAA^       -   C          GC          UCGUAAGC 
 120       110       100         90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Em Fe Ma Ma
Star sequence


MirBase accessionNone
Get sequence
Mature sequence


MirBase accessionNone
Get sequence
Seed sequenceUCAGUGC