MirGeneDB

MirGeneDB ID

Dmo-Mir-9540

Family name MIR-9540 (all species)
Seed UCAGUGC
Species Fruit fly (Drosophila mojavensis)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) D. mojavensis
Node of Origin (family) D. mojavensis
Genome context
(Dmoj_caf1)
scaffold_6540: 6632480-6632542 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUCUAUAUGAAAUAAAUUUUAUAUGACAUAAUUCGUACGUUACACUGAACAGAUUUGUGUACGAAUGCUCUGUUCAGUGCGAUGUGUGAAUCAUGUAUGUAAAAAGAGGCAGCGAAGAUGAAU
Get precursor sequence
Structure
        10           20        30        40        50        60 
GUCUAUAUGAAAUAAAU---|       A   A          UA          AUUUGUGU 
                    UUUAUAUG CAU AUUCGUACGU  CACUGAACAG        \
                    AAAUGUAU GUA UAAGUGUGUA  GUGACUUGUC        A
UAAGUAGAAGCGACGGAGAA^       -   C          GC          UCGUAAGC 
 120       110       100         90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-9540_5p*

MirBase accessionNone
Sequence
0- AUUCGUACGUUACACUGAACAGA -23
Get sequence
Mature sequence

Dmo-Mir-9540_3p

MirBase accessionNone
Sequence
42- UUCAGUGCGAUGUGUGAAUCA -63
Get sequence