MirGeneDB

Gene name

Dmo-Mir-92-o15

Family name MIR-92 (all species)
MiRBase ID dmo-mir-92b
Paralogues Dmo-Mir-92-o14  Dmo-Mir-92-o16  Dmo-Mir-92-o17  Dmo-Mir-92-o19 
Orthologues Asu-Mir-92  Cel-Mir-92  Dan-Mir-92-o15  Dme-Mir-92-o15  Isc-Mir-92 
Node of Origin (gene) Drosophila
Node of Origin (family) Bilateria
Genome context
(Dmoj_caf1)
scaffold_6540: 25731666-25731728 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o15)
Mir-92-o14 scaffold_6540: 25734579-25734639 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGUGCAACAUUAAAACGUCACCUGAUGUAGGUCGUGCCUGGUGCUUAUUUGUUGUUAUGCGAAAAUACAAAUUGCACUAGUCCCGGCCUGCAGUGAGUGUCGCAAACAACGUCUGUGUGUG
Get precursor sequence
Structure
        10          20        30        40        50        60 
GCUGUGCAACAUUAAAA--| U   CUGA         UGC       UU     UUGUUAU 
                   CG CAC    UGUAGGUCG   CUGGUGC  AUUUG       G
                   GC GUG    ACGUCCGGC   GAUCACG  UAAAC       C
GUGUGUGUCUGCAACAAAC^ U   AGUG         CCU       U-     AUAAAAG 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-92-o15_5p*

MirBase accessionNone
Sequence
0- AGGUCGUGCCUGGUGCUUAUUUG -23
Get sequence
Mature sequence

Dmo-Mir-92-o15_3p

MirBase accessionMIMAT0008658
Sequence
41- AAUUGCACUAGUCCCGGCCUGC -63
Get sequence
Seed sequenceAUUGCAC