MirGeneDB

Gene name

Dmo-Mir-9-P9

Family name MIR-9 (all species)
MiRBase ID dmo-mir-9c
Paralogues Dmo-Mir-9-P7  Dmo-Mir-9-P8  Dmo-Mir-9-P10-v1  Dmo-Mir-9-P10-v2  Dmo-Mir-9-P11 
Orthologues Aae-Mir-9-P9  Cin-Mir-9  Cte-Mir-9  Dan-Mir-9-P9  Dme-Mir-9-P9  Dpu-Mir-9-o9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (gene) Diptera
Node of Origin (family) Bilateria
Genome context
(Dmoj_caf1)
scaffold_6500: 7201357-7201423 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-P9)
Mir-306 scaffold_6500: 7201959-7202025 [+] UCSC Ensembl
Mir-9-P10-v1 scaffold_6500: 7202147-7202208 [+] UCSC Ensembl
Mir-9-P10-v2 scaffold_6500: 7202147-7202208 [+] UCSC Ensembl
Mir-9-P8 scaffold_6500: 7202321-7202381 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACAAUUGCCACUCUUUCAUUUUUGCUGUUUCUUUGGUAUUCUAGCUGUAGAUUGUUUUCACAUAUUGUAUCAUCUAAAGCUUUUAUACCAAAGCUCCAGCUUAAAUUGCUUGACACCGCCCAACCG
Get precursor sequence
Structure
        10          20        30        40        50        60   
CACAAUUGCCACUCUUUC--|   UU    UUU         UCU    G    UUGUUUUCAC 
                    AUUU  GCUG   CUUUGGUAU   AGCU UAGA          \
                    UAAA  CGAC   GAAACCAUA   UCGA AUCU          A
GCCAACCCGCCACAGUUCGU^   UU    CUC         UUU    A    ACUAUGUUAU 
     120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-9-P9_5p

MirBase accessionMIMAT0008683
Sequence
0- UCUUUGGUAUUCUAGCUGUAGA -22
Get sequence
Seed sequenceCUUUGGU
Star sequence

Dmo-Mir-9-P9_3p*

MirBase accessionNone
Sequence
45- UAAAGCUUUUAUACCAAAGCUC -67
Get sequence