MirGeneDB

Gene name

Dmo-Mir-67

Family name MIR-67 (all species)
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-307
Paralogues
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cgi-Mir-67-P4  Cgi-Mir-67-P5  Cgi-Mir-67-P6  Cte-Mir-67  Dan-Mir-67  Dan-Mir-67-as  Dme-Mir-67  Dme-Mir-67-as  Dpu-Mir-67  Efe-Mir-67-P1  Efe-Mir-67-P2  Efe-Mir-67-P3  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67  Tca-Mir-67-v1  Tca-Mir-67-v2  Tca-Mir-67-v3 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Dmoj_caf1)
scaffold_6496: 24271692-24271757 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAGAAAACUAAGAAUUUUGUCUUGCUUUGACUCACUCAACCUGGGUGUGAUGUUAUUUCGAUUCGGUAUCCAUCACAACCUCCUUGAGUGAGCGAUAGCAGGAUAGAAUAUCCACAAAGCUAAAC
Get precursor sequence
Structure
        10          20         30        40        50        60  
CAAGAAAACUAAGAAUU--          -|  A         CCU  G       UUAUUUCG 
                   UUGUCUUGCU UUG CUCACUCAA   GG UGUGAUG        A
                   GAUAGGACGA AGC GAGUGAGUU   CC ACACUAC        U
CAAAUCGAAACACCUAUAA          U^  -         CCU  A       CUAUGGCU 
    120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-67_5p*

MirBase accessionNone
Sequence
0- ACUCACUCAACCUGGGUGUGAUG -23
Get sequence
Mature sequence

Dmo-Mir-67_3p

MirBase accessionMIMAT0008665
Sequence
43- UCACAACCUCCUUGAGUGAGCGA -66
Get sequence
Seed sequenceCACAACC