MirGeneDB

Gene name

Dmo-Mir-315

Family name MIR-315 (all species)
MiRBase ID dmo-mir-315
Paralogues
Orthologues Aae-Mir-315  Bge-Mir-315  Cbr-Mir-315  Cel-Mir-315  Cgi-Mir-315-v1  Cgi-Mir-315-v2  Cte-Mir-315  Dan-Mir-315  Dme-Mir-315  Dpu-Mir-315  Efe-Mir-315  Isc-Mir-315  Lan-Mir-315  Lgi-Mir-315  Pfl-Mir-315  Sko-Mir-315  Tca-Mir-315 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dmoj_caf1)
scaffold_6680: 23648579-23648643 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAACCGUCAGCCAAACGGACCCUUAUAUAAUUUUGAUUGUUGCUCAGAAAGCCCGUAAUUUAACUUAACAUGGCUUUCGAGUAAUAAUCGAAACCAAAUAAGGCAUCCAAACAUCAUUUUGUCAA
Get precursor sequence
Structure
        10        20          30        40        50        60  
UAACCGUCAGCCAAACGGAC--|     AUAA               A       CGUAAUUU 
                      CCUUAU    UUUUGAUUGUUGCUC GAAAGCC        A
                      GGAAUA    AAAGCUAAUAAUGAG CUUUCGG        A
AACUGUUUUACUACAAACCUAC^     AACC               -       UACAAUUC 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-315_5p

MirBase accessionMIMAT0008687
Sequence
0- UUUUGAUUGUUGCUCAGAAAGCC -23
Get sequence
Seed sequenceUUUGAUU
Star sequence

Dmo-Mir-315_3p*

MirBase accessionNone
Sequence
43- CUUUCGAGUAAUAAUCGAAACC -65
Get sequence