MirGeneDB

Gene name

Dmo-Mir-2-P4b2

Family name MIR-2 (all species)
MiRBase ID dmo-mir-13b-2
Paralogues Dmo-Mir-2-P1a-v1  Dmo-Mir-2-P1a-v2  Dmo-Mir-2-P1b-v1  Dmo-Mir-2-P1b-v2  Dmo-Mir-2-P2b  Dmo-Mir-2-P3  Dmo-Mir-2-P4a  Dmo-Mir-2-P4b1  Dmo-Mir-2-P5  Dmo-Mir-2-P6a  Dmo-Mir-2-P6b  Dmo-Mir-2-P6c  Dmo-Mir-2-P7  Dmo-Mir-2-P8  Dmo-Mir-2-P9 
Orthologues Aae-Mir-2-P4  Dan-Mir-2-P4b2  Dme-Mir-2-P4b2  Dpu-Mir-2-o4 
Node of Origin (gene) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dmoj_caf1)
scaffold_6473: 13342567-13342628 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCACGCUUCCUCUAAUGCUCCAUAUUUGCGCGUCAAAUUGACUGUGAGCUAUGUUUAUGAGAUUAUCAUAUCACAGCCAUUUUGACGAGUUUGAUGUGGCAGCCACCAACUGCAAACAGCU
Get precursor sequence
Structure
        10         20          30        40        50        60 
UUCACGCUUCCUCUAAU-   -       U-| G       U  A      GC    UUUAUG 
                  GCU CCAUAUU  GC CGUCAAA UG CUGUGA  UAUG      \
                  CGA GGUGUAG  UG GCAGUUU AC GACACU  AUAC      A
UCGACAAACGUCAACCAC   C       UU^ A       U  C      --    UAUUAG 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-2-P4b2_5p*

MirBase accessionNone
Sequence
0- GCGUCAAAUUGACUGUGAGCUAUG -24
Get sequence
Mature sequence

Dmo-Mir-2-P4b2_3p

MirBase accessionMIMAT0008636
Sequence
39- UAUCACAGCCAUUUUGACGAGUU -62
Get sequence
Seed sequenceAUCACAG