MirGeneDB

MirGeneDB ID

Dmo-Mir-2-P4b1

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-13b-1
Paralogues Dmo-Mir-2-P1a-v1  Dmo-Mir-2-P1a-v2  Dmo-Mir-2-P1b-v1  Dmo-Mir-2-P1b-v2  Dmo-Mir-2-P2b  Dmo-Mir-2-P3  Dmo-Mir-2-P4a  Dmo-Mir-2-P4b2  Dmo-Mir-2-P5  Dmo-Mir-2-P6a  Dmo-Mir-2-P6b  Dmo-Mir-2-P6c  Dmo-Mir-2-P7  Dmo-Mir-2-P8  Dmo-Mir-2-P9 
Orthologues Aae-Mir-2-P4  Dan-Mir-2-P4b1  Dme-Mir-2-P4b1  Dpu-Mir-2-o4 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dmoj_caf1)
scaffold_6540: 10568529-10568588 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P4b1)
Mir-2-P3 scaffold_6540: 10568108-10568173 [+] Ensembl
Mir-2-P4a scaffold_6540: 10568361-10568422 [+] Ensembl
Mir-2-P4b1 scaffold_6540: 10568529-10568588 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCAUUCGAAUUGCAAUUUUCUUAUACCAUGUCGUUAAAAUGUCUGUGACCGUAUGUAUUCACUAUCAUAUCACAGCCAUUUUGACGAGUUUGGGUAAAGAAAUCUCAACAGAGCUCGCGU
Get precursor sequence
Structure
        10          20        30          40        50        60
GCAUUCGAAUUGCAAUU--     A    AUG--|          U      CCG    UAUU 
                   UUCUU UACC     UCGUUAAAAUG CUGUGA   UAUG    C
                   AAGAA AUGG     AGCAGUUUUAC GACACU   AUAC    A
UGCGCUCGAGACAACUCUA     -    GUUUG^          C      ---    UAUC 
.       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-2-P4b1_5p*

MirBase accessionNone
Sequence
0- UCGUUAAAAUGUCUGUGACCGUAUG -25
Get sequence
Mature sequence

Dmo-Mir-2-P4b1_3p

MirBase accessionMIMAT0008636
Sequence
37- UAUCACAGCCAUUUUGACGAGUU -60
Get sequence