MirGeneDB

MirGeneDB ID

Dmo-Mir-1010

Family name MIR-1010 (all species)
Seed UUCACCU
Species Fruit fly (Drosophila mojavensis)
MiRBase ID
Paralogues
Orthologues Dan-Mir-1010  Dme-Mir-1010 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dmoj_caf1)
scaffold_6540: 27812521-27812593 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGAGUACACCUCCGUCUUUGUGCUCAACGGGUAAGUGGUGUAGAUGAAACAAAUUUCACAACAAUUUUUUGUUGGAUUGUUUCACCUAUCGUUCCAUUUGCAGGUACGAGGAUUUGGAGCUGUUCAAGGAACU
Get precursor sequence
Structure
        10         20         30           40        50        60    
GGAGUACACCUCCGUCUUU-  G   A-  GG        U---|   A       AAUUUCACAACA 
                    GU CUC  AC  GUAAGUGG    GUAG UGAAACA            A
                    UA GAG  UG  CGUUUACC    UAUC ACUUUGU            U
UCAAGGAACUUGUCGAGGUU  G   CA  GA        UUGC^   C       UAGGUUGUUUUU 
 130       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-1010_5p*

MirBase accessionNone
Sequence
0- GUAAGUGGUGUAGAUGAAACA -21
Get sequence
Mature sequence

Dmo-Mir-1010_3p

MirBase accessionNone
Sequence
49- UUUCACCUAUCGUUCCAUUUGCAG -73
Get sequence