MirGeneDB

Gene name

Dan-Novel-12-P2

Family name DAN-NOVEL-12 (all species)
MiRBase ID
Paralogues Dan-Novel-12-P1 
Orthologues
Node of Origin (gene) D. ananassae
Node of Origin (family) D. ananassae
Genome context
(Dana_caf1)
scaffold_13045: 592980-593037 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAUACGUGUGCCCUUGCAUUCUCUGGCCAAAAGCUGGCGGAAAAAAUCGUCUUGAAUAUCUGACGAUUUGUUUCGGCAGCUUUUGGCCAAAGAAUAUUUUCGUCCAAGAACAUCAG
Get precursor sequence
Structure
        10          20        30        40        50        
AAAAUACGUGUGCCCUUGC--|    C             G     A       CUUGA 
                     AUUCU UGGCCAAAAGCUG CGGAA AAAUCGU     A
                     UAAGA ACCGGUUUUCGAC GCUUU UUUAGCA     U
GACUACAAGAACCUGCUUUUA^    A             G     G       GUCUA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Da
Mature sequence

Dan-Novel-12-P2_5p

MirBase accessionNone
Sequence
0- AAAAGCUGGCGGAAAAAAUCGU -22
Get sequence
Seed sequenceAAAGCUG
Co-mature sequence

Dan-Novel-12-P2_3p

MirBase accessionNone
Sequence
36- GAUUUGUUUCGGCAGCUUUUGG -58
Get sequence
Seed sequenceAUUUGUU