MirGeneDB

MirGeneDB ID

Dan-Novel-10

Family name DAN-NOVEL-10 (all species)
Seed CAUAGAU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) D. ananassae
Node of Origin (family) D. ananassae
Genome context
(Dana_caf1)
scaffold_12903: 559716-559778 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUGCCUGAAAUAUGUAUGUUUUUAAAAUUUUUACGUCUGUCCAAUUAUUUUGUGUUUAUUUUUAUUUCACAACAUAGAUGGCCAGACGUUACAAUUUUUUAAACAAAGCGGCUGUGAAGGAAA
Get precursor sequence
Structure
        10          20        30        40        50        60 
UUGCCUGAAAUAUGUAU--|   UU      UUU       U   A    U   UGUUUAUU 
                   GUUU  AAAAUU   ACGUCUG CCA UUAU UUG        \
                   CAAA  UUUUAA   UGCAGAC GGU GAUA AAC        U
AAAGGAAGUGUCGGCGAAA^   UU      CAU       C   A    C   ACUUUAUU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Da
Star sequence

Dan-Novel-10_5p*

MirBase accessionNone
Sequence
0- UUACGUCUGUCCAAUUAUUUUG -22
Get sequence
Mature sequence

Dan-Novel-10_3p

MirBase accessionNone
Sequence
41- ACAUAGAUGGCCAGACGUUACA -63
Get sequence