MirGeneDB

Gene name

Dan-Mir-978-v1

Family name MIR-978 (all species)
MiRBase ID
Paralogues Dan-Mir-978-v2 
Orthologues Dme-Mir-978-v1 
Node of Origin (gene) D. melanogaster group
Node of Origin (family) D. melanogaster group
Genome context
(Dana_caf1)
scaffold_13417: 2460540-2460602 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCGGACAGGGCAAGCUCGGCGGCACAGACAGCAUUCGACGCUGCUGGCUUACGUGGUGGUUGAUAUCCGUGUCCAGUGACGUUGAUUGCAGUUGUGUAGACGCGAAUUACAGCGACCGAUAG
Get precursor sequence
Structure
        10        20           30        40        50        60 
UGCGGACAGGGCAAGCUCG   ---|     ACA   U      CU     CU    UGGUGG 
                   GCG   GCACAG   GCA UCGACG  GCUGG  UACG      U
                   CGC   UGUGUU   CGU AGUUGC  UGACC  GUGC      U
GAUAGCCAGCGACAUUAAG   AGA^     GA-   U      AG     U-    CUAUAG 
 120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Da
Star sequence

Dan-Mir-978-v1_5p*

MirBase accessionNone
Sequence
0- AGCAUUCGACGCUGCUGGCUUACGUG -26
Get sequence
Mature sequence

Dan-Mir-978-v1_3p

MirBase accessionNone
Sequence
40- UGUCCAGUGACGUUGAUUGCAGU -63
Get sequence
Seed sequenceGUCCAGU