MirGeneDB

MirGeneDB ID

Dan-Mir-974

Family name MIR-974 (all species)
Seed AGCGAGC
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Dme-Mir-974  Dmo-Mir-974 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_13417: 2478498-2478562 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAUCCUGGCUUGGGGUAGGUCAUCUCCUCUAAGCGAGCAAAGAAGUAGUAUUUGUUUGCUUUUAAUGGUCAAAUAUAACUUUUUUGGAAGCUACGAGGAGUUGUCCUCAGCGCUUAUGAAAUCGA
Get precursor sequence
Structure
        10          20        30        40        50        60  
AAUCCUGGCUUGGGGUA--| U  U      UA   GAG         A     UGUUUGCUU 
                   GG CA CUCCUC  AGC   CAAAGAAGU GUAUU         \
                   CC GU GAGGAG  UCG   GUUUUUUCA UAUAA         U
AGCUAAAGUAUUCGCGACU^ U  U      CA   AAG         A     ACUGGUAAU 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUGUG in loop
Tissue expression
 +
Da
Mature sequence

Dan-Mir-974_5p

MirBase accessionNone
Sequence
0- AAGCGAGCAAAGAAGUAGUAUU -22
Get sequence
Star sequence

Dan-Mir-974_3p* (predicted)

MirBase accessionNone
Sequence
43- UAUAACUUUUUUGGAAGCUACG -65
Get sequence