MirGeneDB

Gene name

Dan-Mir-964

Family name MIR-964 (all species)
MiRBase ID
Paralogues
Orthologues Dme-Mir-964-v1  Dme-Mir-964-v2  Dmo-Mir-964 
Node of Origin (gene) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_12916: 11085596-11085658 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAUGAGCAUCGAAUCAAAGUCAAACUUGUUUUAGAAUAGGGGAGCUUAACUUAUUGGAGAGUUGAUAUUAAGUUAAGAUCCCUAAUUCUAAGAUAAUGUGACCAUUAAUGCAACGUUGUUUUA
Get precursor sequence
Structure
        10           20        30        40        50        60 
GAUGAGCAUCGAAUCAAA---|   AAC            A     G        AUUGGAGA 
                     GUCA   UUGUUUUAGAAU GGGGA CUUAACUU        \
                     CAGU   AAUAGAAUCUUA UCCCU GAAUUGAA        G
AUUUUGUUGCAACGUAAUUAC^   GU-            A     A        UUAUAGUU 
 120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-964_5p

MirBase accessionNone
Sequence
0- UUAGAAUAGGGGAGCUUAACUU -22
Get sequence
Seed sequenceUAGAAUA
Star sequence

Dan-Mir-964_3p* (predicted)

MirBase accessionNone
Sequence
41- GUUAAGAUCCCUAAUUCUAAGA -63
Get sequence