MirGeneDB

Gene name

Dan-Mir-92-o14

Family name MIR-92 (all species)
MiRBase ID dan-mir-92a
Paralogues Dan-Mir-92-o15  Dan-Mir-92-o16  Dan-Mir-92-o17  Dan-Mir-92-o18  Dan-Mir-92-o19 
Orthologues Asu-Mir-92  Cel-Mir-92  Dme-Mir-92-o14  Dmo-Mir-92-o14  Isc-Mir-92 
Node of Origin (gene) Drosophila
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13340: 3727792-3727850 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o14)
Mir-92-o15 scaffold_13340: 3732660-3732721 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUCCAUCGAAUAUAAUACAAAUUUCCCGUAGGACGGGAAGGUGUCAAGGUUUUGAAUUAAAUUAAACAUUGCACUUGUCCCGGCCUAUGGGCGGUUUGUCAAACACAUCGAUACAUAU
Get precursor sequence
Structure
        10          20        30         40        50         
UUUCCAUCGAAUAUAAU--      UU        A     -|    U   G   UUGAAU 
                   ACAAAU  CCCGUAGG CGGGA AGGUG CAA GUU      \
                   UGUUUG  GGGUAUCC GCCCU UUCAC GUU CAA      U
UAUACAUAGCUACACAAAC      GC        G     G^    -   A   AUUAAA 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-92-o14_5p*

MirBase accessionNone
Sequence
0- AGGACGGGAAGGUGUCAAGGUU -22
Get sequence
Mature sequence

Dan-Mir-92-o14_3p

MirBase accessionMIMAT0008412
Sequence
37- CAUUGCACUUGUCCCGGCCUAU -59
Get sequence
Seed sequenceAUUGCAC