MirGeneDB

MirGeneDB ID

Dan-Mir-7

Family name MIR-7 (all species)
Seed GGAAGAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-7
Paralogues
Orthologues Aae-Mir-7  Aca-Mir-7-P1  Aca-Mir-7-P2  Aca-Mir-7-P3  Ami-Mir-7-P1  Ami-Mir-7-P2  Ami-Mir-7-P3  Ami-Mir-7-P4  Asu-Mir-7  Bfl-Mir-7  Bge-Mir-7  Bta-Mir-7-P1  Bta-Mir-7-P2  Bta-Mir-7-P3  Cfa-Mir-7-P1  Cfa-Mir-7-P2  Cfa-Mir-7-P3  Cgi-Mir-7  Cin-Mir-7  Cli-Mir-7-P1  Cli-Mir-7-P2  Cli-Mir-7-P3  Cli-Mir-7-P4  Cpi-Mir-7-P1  Cpi-Mir-7-P2  Cpi-Mir-7-P3  Cpi-Mir-7-P4  Cpo-Mir-7-P1  Cpo-Mir-7-P2  Cpo-Mir-7-P3  Cte-Mir-7  Dme-Mir-7  Dmo-Mir-7  Dno-Mir-7-P1  Dno-Mir-7-P2  Dno-Mir-7-P3  Dpu-Mir-7-P5  Dpu-Mir-7-P6  Dre-Mir-7-o1  Dre-Mir-7-P1  Dre-Mir-7-P2a  Dre-Mir-7-P2b  Efe-Mir-7-P7  Efe-Mir-7-P8  Efe-Mir-7-P9  Ete-Mir-7-P1  Ete-Mir-7-P2  Ete-Mir-7-P3  Gga-Mir-7-P1a  Gga-Mir-7-P1b  Gga-Mir-7-P2  Gga-Mir-7-P3  Hme-Mir-7  Hsa-Mir-7-P1  Hsa-Mir-7-P2  Hsa-Mir-7-P3  Isc-Mir-7  Lan-Mir-7  Lgi-Mir-7  Mdo-Mir-7-P1  Mdo-Mir-7-P2  Mdo-Mir-7-P3  Mml-Mir-7-P1  Mml-Mir-7-P2  Mml-Mir-7-P3  Mmu-Mir-7-P1  Mmu-Mir-7-P2  Mmu-Mir-7-P3  Oan-Mir-7-P1  Oan-Mir-7-P2  Ocu-Mir-7-P1  Ocu-Mir-7-P2  Ocu-Mir-7-P3  Pfl-Mir-7  Pmi-Mir-7  Rno-Mir-7-P1  Rno-Mir-7-P2  Rno-Mir-7-P3  Sha-Mir-7-P1  Sha-Mir-7-P2  Sha-Mir-7-P3  Sko-Mir-7  Spu-Mir-7  Sto-Mir-7-P1  Sto-Mir-7-P2  Sto-Mir-7-P3  Tgu-Mir-7-P1  Tgu-Mir-7-P2c  Tgu-Mir-7-P2d  Tgu-Mir-7-P3  Xtr-Mir-7-P1  Xtr-Mir-7-P2  Xtr-Mir-7-P4 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13266: 4109379-4109440 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CCUGGGAGUCCUGUGGAAGUGCAUUCCGUAUGGAAGACUAGUGAUUUUGUUGUUUGGUUUAUGGUAAUAACAAUAAAUCCCUUGUCUUCUUACGGCGUGCAUUCGGCUCAUCACUCUAUCGA
Get precursor sequence
Structure
        10          20        30        40        50        60 
CCUGGGAGUCCUGUGGA--|      U     U       U  U     U      UGGUUU 
                   AGUGCAU CCGUA GGAAGAC AG GAUUU GUUGUU      A
                   UUACGUG GGCAU UCUUCUG UC CUAAA UAACAA      U
AGCUAUCUCACUACUCGGC^      C     -       U  C     -      UAAUGG 
120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-7_5p

MirBase accessionMIMAT0008410
Sequence
0- UGGAAGACUAGUGAUUUUGUUGUU -24
Get sequence
Star sequence

Dan-Mir-7_3p*

MirBase accessionNone
Sequence
40- CAAUAAAUCCCUUGUCUUCUUA -62
Get sequence