MirGeneDB

MirGeneDB ID

Dan-Mir-3-P2

Family name MIR-3 (all species)
Seed CACUGGG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-309
Paralogues Dan-Mir-3-P1  Dan-Mir-3-P3 
Orthologues Aae-Mir-3-P2a1  Aae-Mir-3-P2a2  Aae-Mir-3-P2b  Bge-Mir-3-o2a-v1  Bge-Mir-3-o2a-v2  Bge-Mir-3-o2b-v1  Bge-Mir-3-o2b-v2  Dme-Mir-3-P2  Dmo-Mir-3-P2  Dpu-Mir-3  Hme-Mir-3-o2 
Node of Origin (locus) Drosophila
Node of Origin (family) Pancrustacea
Genome context
(Dana_caf1)
scaffold_13266: 9731119-9731176 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-3-P2)
Mir-3-P2 scaffold_13266: 9731119-9731176 [+] Ensembl
Mir-3-P1 scaffold_13266: 9731233-9731293 [+] Ensembl
Mir-279-P2 scaffold_13266: 9731371-9731449 [+] Ensembl
Mir-9-P11 scaffold_13266: 9731536-9731592 [+] Ensembl
Mir-2-P5 scaffold_13266: 9731684-9731746 [+] Ensembl
Mir-2-P6a scaffold_13266: 9731826-9731883 [+] Ensembl
Mir-2-P6b scaffold_13266: 9731970-9732041 [+] Ensembl
Mir-2-P6c scaffold_13266: 9732130-9732191 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCCGCGAGUUACAAAGUGAAGAUCAUUAUACGACAAACCUUGUUCGGUUUUGCCAAUUUCCUAGCAGCACUGGGUAAAGUUUGUCCUAUAAUCUAUAAAAAAGCCGUCCAGACAUCUG
Get precursor sequence
Structure
        10             20        30        40        50        
GCCGCGAGUUACAAAGUGA-----|   CAU    C       C   UU    U   CCAAU 
                        AGAU   UAUA GACAAAC UUG  CGGU UUG     U
                        UCUA   AUAU CUGUUUG AAU  GUCA GAC     U
GUCUACAGACCUGCCGAAAAAAUA^   ---    C       A   GG    C   GAUCC 
      110       100           90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-3-P2_5p*

MirBase accessionNone
Sequence
0- CGACAAACCUUGUUCGGUUUUG -22
Get sequence
Mature sequence

Dan-Mir-3-P2_3p

MirBase accessionMIMAT0008453
Sequence
36- GCACUGGGUAAAGUUUGUCCUA -58
Get sequence