MirGeneDB

Gene name

Cpo-Mir-216-P1b

Family name MIR-216 (all species)
MiRBase ID cpo-mir-216b
Paralogues Cpo-Mir-216-P1a 
Orthologues Aca-Mir-216-P1b  Ami-Mir-216-P1b  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1b  Cel-Mir-216-P1  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1b  Cpi-Mir-216-P1b  Dme-Mir-216-P1  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1b  Gga-Mir-216-P1b  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1b  Mml-Mir-216-P1b  Mmu-Mir-216-P1b  Ocu-Mir-216-P1b  Rno-Mir-216-P1b  Sha-Mir-216-P1b  Tca-Mir-216-P1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(cavPor3)
scaffold_48: 8638120-8638180 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P1b)
Mir-216-P1a scaffold_48: 8647413-8647474 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUAAAUACAAUGUCAGAGUGGCAGACUGGAAAAUCUCUGCAGGCAAAUGUGAUGUCACUGAAGAAUCACACACUUACCUGUAAAGAUUCUGCAGUCUGACAGCUUCCAGCAUCAAACUGUU
Get precursor sequence
Structure
        10         20         30        40        50          
UUAAAUACAAUGUCAGA-  GG-|      GAA     C      C  A    AUGUCACU 
                  GU   CAGACUG   AAUCU UGCAGG AA UGUG        \
                  CG   GUCUGAC   UUAGA AUGUCC UU ACAC        G
UUGUCAAACUACGACCUU  ACA^      GUC     A      A  C    ACUAAGAA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Cpo-Mir-216-P1b_5p

MirBase accessionMIMAT0047121
Sequence
0- AAAUCUCUGCAGGCAAAUGUGA -22
Get sequence
Seed sequenceAAUCUCU
Star sequence

Cpo-Mir-216-P1b_3p*

MirBase accessionMIMAT0047122
Sequence
39- ACACUUACCUGUAAAGAUUCUG -61
Get sequence