
Gene name


Family name MIR-29 (all species)
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-29a-2
Paralogues Cpi-Mir-29-P1a  Cpi-Mir-29-P2a  Cpi-Mir-29-P2b-v1  Cpi-Mir-29-P2b-v2 
Orthologues Aca-Mir-29-P1b  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1b  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dno-Mir-29-P1b  Ete-Mir-29-P1b  Gga-Mir-29-P1b  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1b  Mml-Mir-29-P1b  Mmu-Mir-29-P1b  Oan-Mir-29-P1b  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1b  Tgu-Mir-29-P1b  Xtr-Mir-29-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
JH584931: 87938-87997 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-29-P1b)
Mir-29-P2b-v1 JH584931: 90890-90953 [-] UCSC
Mir-29-P2b-v2 JH584931: 90891-90952 [-] UCSC
(pre-Mir +30nt flank)
Get precursor sequence
        10            20         30        40        50          
GAGCUGGGAAAAUCUCU----      -| GGC        C  UCU       C   GUUUCA 
                     CUUACA CA   UGACCGAU UC   UGGUGUU AGA      \
                     GGAUGU GU   AUUGGCUA AG   ACCACGA UCU      G
AGGUAAUCCCAACGAAAAGGG      A^ ---        A  UUU       -   GUUUUU 
.       110       100           90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Te Te Te To
Star sequence


MirBase accessionMIMAT0037670
Get sequence
Mature sequence


MirBase accessionMIMAT0037669
Get sequence
Seed sequenceAGCACCA