MirGeneDB

Gene name

Cpi-Mir-1-P3

Family name MIR-1 (all species)
MiRBase ID cpi-mir-206
Paralogues Cpi-Mir-1-P1  Cpi-Mir-1-P2  Cpi-Mir-1-P4 
Orthologues Aca-Mir-1-P3  Ami-Mir-1-P3  Asu-Mir-1  Bfl-Mir-1  Bta-Mir-1-P3  Cel-Mir-1  Cfa-Mir-1-P3  Cgi-Mir-1  Cli-Mir-1-P3  Cpo-Mir-1-P3  Cte-Mir-1  Dme-Mir-1  Dno-Mir-1-P3  Dpu-Mir-1  Dre-Mir-1-P3a  Dre-Mir-1-P3b  Ete-Mir-1-P3  Gga-Mir-1-P3  Hsa-Mir-1-P3  Isc-Mir-1  Lgi-Mir-1  Mdo-Mir-1-P3  Mml-Mir-1-P3  Mmu-Mir-1-P3  Ocu-Mir-1-P3  Pfl-Mir-1  Pmi-Mir-1  Rno-Mir-1-P3  Sha-Mir-1-P3  Sko-Mir-1  Spu-Mir-1  Tca-Mir-1  Xtr-Mir-1-P3 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(chrPic1)
JH584857: 808079-808138 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-1-P3)
Mir-133-P3-v1 JH584857: 801505-801563 [-] UCSC
Mir-133-P3-v2 JH584857: 801505-801563 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GACUGACAGACAGACUUCUCUUUUGAGACAACAUGCUUCUUUAUAUCCCCAUAUGAAUUAUGCUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCAGGGAGAUGAAAUUAUAUACACCAUC
Get precursor sequence
Structure
        10           20        30        40        50          
GACUGACAGACAGACUU---|     U     A                CC     UGAAUU 
                    CUCUUU GAGAC ACAUGCUUCUUUAUAU  CCAUA      \
                    GAGGGA CUUUG UGUGUGAAGGAAUGUA  GGUAU      A
CUACCACAUAUAUUAAAGUA^     -     G                A-     CGUCGU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Te Te Te To
Star sequence

Cpi-Mir-1-P3_5p*

MirBase accessionMIMAT0037833
Sequence
0- ACAUGCUUCUUUAUAUCCCCAUA -23
Get sequence
Mature sequence

Cpi-Mir-1-P3_3p

MirBase accessionMIMAT0037834
Sequence
38- UGGAAUGUAAGGAAGUGUGUGG -60
Get sequence
Seed sequenceGGAAUGU