MirGeneDB

Gene name

Cli-Mir-29-P1b

Family name MIR-29 (all species)
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-29a-2
Paralogues Cli-Mir-29-P1a  Cli-Mir-29-P2a  Cli-Mir-29-P2b-v1  Cli-Mir-29-P2b-v2 
Orthologues Aca-Mir-29-P1b  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cpi-Mir-29-P1b  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dno-Mir-29-P1b  Ete-Mir-29-P1b  Gga-Mir-29-P1b  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1b  Mml-Mir-29-P1b  Mmu-Mir-29-P1b  Oan-Mir-29-P1b  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1b  Tgu-Mir-29-P1b  Xtr-Mir-29-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold454: 2207703-2207762 [-]
Clustered MiRNAs
(< 10kb from Mir-29-P1b)
Mir-29-P2b-v1 scaffold454: 2208566-2208628 [-]
Mir-29-P2b-v2 scaffold454: 2208567-2208627 [-]
Precursor
(pre-Mir +30nt flank)
GAGCCAGGACAAUGUCUCUUACACAGGCUGACCGAUUUCUCUUGGUGUUCAGAGUCUCAGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGAAAAGCAACAGUAAAGGA
Get precursor sequence
Structure
        10            20         30        40        50          
GAGCCAGGACAAUGUCU----      -| GGC           UCU       C   GUCUCA 
                     CUUACA CA   UGACCGAUUUC   UGGUGUU AGA      \
                     GGAUGU GU   AUUGGCUAAAG   ACCACGA UCU      G
AGGAAAUGACAACGAAAAGGG      A^ ---           UUU       -   GUUUUU 
.       110       100           90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-29-P1b_5p* (predicted)

MirBase accessionNone
Sequence
0- ACCGAUUUCUCUUGGUGUUCAGA -23
Get sequence
Mature sequence

Cli-Mir-29-P1b_3p

MirBase accessionMIMAT0038448
Sequence
38- UAGCACCAUUUGAAAUCGGUUA -60
Get sequence
Seed sequenceAGCACCA