MirGeneDB

Gene name

Cli-Mir-216-P1b

Family name MIR-216 (all species)
MiRBase ID cli-mir-216b
Paralogues Cli-Mir-216-P1a 
Orthologues Aca-Mir-216-P1b  Ami-Mir-216-P1b  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1b  Cel-Mir-216-P1  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cpi-Mir-216-P1b  Cpo-Mir-216-P1b  Dme-Mir-216-P1  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1b  Gga-Mir-216-P1b  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1b  Mml-Mir-216-P1b  Mmu-Mir-216-P1b  Ocu-Mir-216-P1b  Rno-Mir-216-P1b  Sha-Mir-216-P1b  Tca-Mir-216-P1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold628: 125966-126027 [+]
Clustered MiRNAs
(< 10kb from Mir-216-P1b)
Mir-216-P1a scaffold628: 130781-130841 [+]
Mir-217-v2 scaffold628: 133576-133636 [+]
Mir-217-v1 scaffold628: 133577-133635 [+]
Precursor
(pre-Mir +30nt flank)
CUUCAACCUGGAUAAAAGUCGCAGACUGGGAAAUCUCUGCAGGCAAAUGUGAUGUCUUUAUAGCAAUCUCACAAUUACCUGUAGAGAUUCUACAAUCUGGCACCUUCAGACACAGUAAUUAU
Get precursor sequence
Structure
        10        20           30        40        50        60
CUUCAACCUGGAUAAAAGUC- -    C  -|   A          C  A     UGUCUUU 
                     G CAGA UG GGAA UCUCUGCAGG AA UGUGA       A
                     C GUCU AC UCUU AGAGAUGUCC UU ACACU       U
UAUUAAUGACACAGACUUCCA G    A  A^   -          A  A     CUAACGA 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Mature sequence

Cli-Mir-216-P1b_5p

MirBase accessionMIMAT0038598
Sequence
0- AAAUCUCUGCAGGCAAAUGUGA -22
Get sequence
Seed sequenceAAUCUCU
Star sequence

Cli-Mir-216-P1b_3p*

MirBase accessionMIMAT0038599
Sequence
40- ACAAUUACCUGUAGAGAUUCUA -62
Get sequence