
Gene name


Family name CIN-NOVEL-3 (all species)
MiRBase ID
Paralogues Cin-Novel-3-P1a  Cin-Novel-3-P1b  Cin-Novel-3-P1d  Cin-Novel-3-P2  Cin-Novel-3-P3 
Node of Origin (gene) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
4: 773632-773685 [-] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10          20        30        40        50       
CUAAAUGUUUGGUCACUAU--|  U   U                A       UCGUA 
                     UCC CAC UUUUACUCUUCUAUUA UUCUGCA     \
UCCUCAAAACACGUCAACAUU^  U   U                -       UUGAC 
  110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence


MirBase accessionNone
Get sequence
Seed sequenceACUCUUC
Star sequence


MirBase accessionNone
Get sequence