MirGeneDB

MirGeneDB ID

Cin-Novel-3-P1c

Family name CIN-NOVEL-3 (all species)
Seed ACUCUUC
Species Sea Squirt (Ciona intestinalis)
MiRBase ID
Paralogues Cin-Novel-3-P1a  Cin-Novel-3-P1b  Cin-Novel-3-P1d  Cin-Novel-3-P2  Cin-Novel-3-P3 
Orthologues
Node of Origin (locus) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(ci3)
4: 773632-773685 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUAAAUGUUUGGUCACUAUUCCUCACUUUUUACUCUUCUAUUAAUUCUGCAUCGUAUCAGUUUGCAGAAUAGUAGAAGAGUAAAGUGUGUGGAUUACAACUGCACAAAACUCCU
Get precursor sequence
Structure
        10          20        30        40        50       
CUAAAUGUUUGGUCACUAU--|  U   U                A       UCGUA 
                     UCC CAC UUUUACUCUUCUAUUA UUCUGCA     \
                     AGG GUG GAAAUGAGAAGAUGAU AAGACGU     U
UCCUCAAAACACGUCAACAUU^  U   U                -       UUGAC 
  110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Novel-3-P1c_5p

MirBase accessionNone
Sequence
0- UACUCUUCUAUUAAUUCUGCAUC -23
Get sequence
Star sequence

Cin-Novel-3-P1c_3p*

MirBase accessionNone
Sequence
32- UGCAGAAUAGUAGAAGAGUAAA -54
Get sequence